Transcript asmbl_21081

Sequence
Transcript Sequence for observation asmbl_21081 of TGE0001355:
CGCCCCTCGGCTCGGTGGTAGGCTGAGACGGGAGGGTCCTCGGCTAAAGCCCAAAGCGGATCAAAGTGGTGGGACTCGCGCCGCGGCCGCGGAGACGTGAAGGCCCTCCGCACGCTCCTCCCGATCCCGGTCGGTGCTCGCCCTCGCTGTGCTCCCAGTCCCCATGGAGAAGACGGAGCTGATCCAGAAGGCGAAGCTGGCCGAGCAGGCCGAGCGCTACGACGACATGGCCACCTGCATGAAGGCCGTGACGGAGCAGGGCGCCGAGCTGTCCAACGAGGAGCGCAACCTGCTCTCGGTGGCCTACAAGAACGTGGTAGGGGGCCGCAGGTCCGCCTGGAGGGTCATCTCGAGCATCGAGCAGAAAACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAGGACTATCGGGAGAAAGTGGAGTCGGAGCTGCGGTCCATCTGCACCACCGTCCTGGAATTGTTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAAATGAAGGGAGATTACTTCCGGTACCTTGCAGAAGTTGCATGTGGTGATGATCGAAAACAAACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCTTTTGATATAAGCAAGAAAGAGATGCAGCCCACACACCCAATTCGTCTGGGGCTGGCTCTTAACTTTTCTGTATTTTACTATGAGATCCTTAATAACCCAGAGCTTGCCTGCACACTGGCTAAAACGGCTTTCGATGAGGCTATTGCAGAACTTGATACACTGAATGAAGACTCTTACAAAGACAGCACCCTCATCATGCAGTTGCTTAGAGACAACCTAACATTGTGGACATCAGACAGTGCAGGAGAAGAATGCGATGCGGCAGAAGGGGCAGAAAACTAACTGCACGCAGGATGTCGTCCTTCTTCCCTCCAGAAACCTTTTTACACATCTCTGTTCCTTATTCCATTCGGATTTCCTATAGCGAAGAAACGCATTCATGTGTATGGAATCAACTGTTTATAGTCTTTTCACACTGCAGCTTTGGGAAAACTCCATTCCTTGATTTGTGTTTGTCTTGGCCTTCCCGGTGTGCAGTTACTGCTGTAGAAAAGTATTAATAGCTTCATTTCATATGAACATAAGTAACTTCCAAACACTTACATAGAGGACTAAAAATGTATCTGGTATTTAAGTAATCTGAACCAGTTCTGCAAGTGACTGTGTTTTGTATTACTGTGAAGATATGAAAATGTAGTTAATTACAGTTTAAAGAGTGTTCTACATAACTTCTTAATTTCTACATTCCCTCCCTTACTCTTTTTTTGGGGGTTTCCTTTCAGTAAAAACTTTTCCATGTTCTTAATGTATTCCTTTTTGGTAGGAATTCAGAAGTATTAGATTGAATGGAAAAGCATTTGACATTTCCGGGCTGGGGGTCACAAATTAAAATGCCTCCTGTATCACATACAATGGGGTTCCTGTGTATCTGTGACAACAGGGAGTTTCCTTATTCACTCTTCATTTGCTGCTGTTTCAGTTGACAACTTCCCTTCCCAATAAAAATTCACTTACGCCTCCCGCCTTTGTAGTTCTGGTATTCACTTTACTATGTAATAGAAGTAGCATGTTGCTGCCAGAATACAAGCCTTGCTTTTGGCAAATTAAAGTGCATGTCATTTCTTAATACACTAGAAAGGGGAAATAAATTAAGTACACAAGTCCAAGTCTAAAACTTTAGTACTTTTCCATGCAGATTTGTGCACATGTGAGAGGGTGTCCAGTTTGTCTAGTGATTGTTATTTAGAGAGTTGGACCACTATTGTGTGTTGCTAATCATTGACTGTAGTCCCAAAAAAGCCTTGTGAAAATGTTATGCCCTATGTAACAGCAGAGTAACATAAAATAAAATTACATTTTATAAACCATTTACTATGGCTTTGTAACAATTGCATACTCATATTTTAAGGGACAAGTGAATTTACTACTTTCTGAAGTTTATTGATACTTCCCTTTTATGTAAAATGTAGTGATGCCCATATTTCTGCATTGTAATACACTTGTCTAGGGATGTCTGGAAATGTATAAAATTGGCCTACGTTTCTTAGAGTTAGTGTTTTATTCACAGATCGGTTTTGTGGGCCATCTCTTTCTCAGATGTAAATGATACCTAGTTAAGTGTTATATGGAATAAAGTGGACATTTTAAAACTAGAAAAGTTAATTATGTGATTGTGAATGCTTTGGGTGGTATTAGAATTAAGCTTTAGCGGATATTCAAACAATGTCAAAGTACAAGAATA