Transcript asmbl_20576

Sequence
Transcript Sequence for observation asmbl_20576 of TGE0004203:
CTGCCGCAGGTTTCCAATAGCTTCTGCACACCGGAACTCAGGTGGAGCAGAGACCCAGAAGTCCTGCGCTGTTTGGTGAGCGTGTACGCATAGCGCAATCTCGCGTGCTGGCCCGGGGCGAACAGAGCTGCCAGATACTTTGTTGTAAGAAATTGAACATGGCAGAAGAAGAGGACTATATGTCTGATTCCTTCATTAACGTCCAAGAAGATATCAGACCGGGATTGCCAATGCTGAGGCAAATTCGAGAAGCTCGTCGAAAAGAAGAAAAGCAGCAGGAAGCTAATTTGAAAAATAGGCAGAAGAGTTTAAAAGAAGAAGAACAAGAAAGACGTGACATTGGGTTGAAGAATGCACTAGGCTGTGAAAACAAAGGGTTTGCTTTGCTCCAAAAGATGGGATATAAAAGTGGCCAGGCCCTTGGCAAGAGTGGAGATGGTATTGTTGAACCAATTCCTCTCAATGTCAAAACAGGGAAAAGTGGCATTGGTCATGAGGCATTGTTAAAACGGAAAGCAGAGGAAAAATTAGAAAGCTACAGAAGAAAGATTAATGTGAAAAAGCAAACTGAAGAAAAAGCTGCAGAACAGTTTCGAATGCGACTTAAAAATAAGCAAGATGAAATGAAGCTAGAAGGAGATCTTAGAAGAAGCCAGCGAGCCTGTCAACAATTGGATACTCAGAAGAATATTCAGGTTCCCAGGGAGGCCTGGTACTGGTTGAGGCTTGAAGAAGAGACTGAAGAAGAGGAAGAGGAAGAAAAAGAACAAGATGAAGATGAATATAAGAGTGAAGATTTAAGTGTACTGGACAAATTACAAATATTGACTAGTTATTTAAGAGAAGAACATCTGTATTGTATTTGGTGTGGAACAGCCTATGAAGATGAAGAAGACCTGTCTTCACATTGCCCAGGACCAACTTCCGCAGATCACGACTAAGAGTAGTCTCAATAAAGTAGAAATCTGGAAAATGCTGTTATTCTCAAAGACAGATAGTTGAGCAGTTAGAATTCCCAGATTTTGGACACCAGTAAAGAAAGAGGGCCTTATATATTTTGTTCTTTTTCTACTTTCGAAGTCCTTCATACTTTAGAATTGTTCACTGACCTCCAAAAATATAATGGAATGCTATTTCAGAACATGAGTTATAGACACGGGCCATTACAATTTATGACTCTGTTGTGATACTTATGGAGTTTAAGGGACACCAGCAGGTAACTCCCTTATTCCTCTCTTCACTTCAGAACAAATTGAAAAATAAGACATGGGAGCCAGCTTTATTATCAGTGAAGCTGAAATAGACGGCAAGGCTGATTTGTTCTCTAGTCAGACTCCCTAACATAGCTCTGTGATTGGAGAGACTGCAGACCTCGGTGAGAACACAGCCCATTTCACATTTTCAGACTAGTTAGCTTTCAAGGTGACAGAATCTACTAGGGGCTGGGCCACACAGGCTAGGTTCCTTCTCTCAATAGCACTCATCAGATAAGACATCTCTCTGTTGAAAGAGAATCAATGAGGGTTCACAGAGCTTGTTCCTGTACTTCTCAGAGCTCACTGCCTTAGCTGGGTAGCTCTAAGTGATTTTTAAAGTTATTTTTTCTGTCTTAAGCTGAAATCTGCTTCCTAAAATTTAATTGAGTACAGCTAAGGACATATATACCATGGCACACCTCTAGAGCTTCATCCAAGGTTGGGCATCAAAATCATGAAGCTTTTTTAAAATTCAGAAGCTCAGGTACCTCTCTCTTAGTGATTTTGATTCAGCTAATCTAGGATAGTTTCTTGATATCTATATTTAAAGTTCTAAGAATGAGTGTGATAAGCATATGTGGATGAGAACTAGTGCTATATATTAAACATAGAGCACTGCTATTCTTAGAATTGAGATGTCCCTGCACAGCTTACATCTCACCTTTTAGTAACACTGAGCAAGAGGTCAACCTCTTCTTCCTGTTTTAGAAACAGCATATGCAAGAACATAGCAAAAGCTAACCTATTCTGGCACAAGTTAAGATAATCAATAGTGCAACTTTTTTTTAGCCTCTGACCTAATATGACCTAATTCACTTGTTCTTGAGTTTAACTTGGGGAACTTTAAAAAATAATACAAGGGTCAGGCCCCCAGAAATTCTGATGTAGTTGGTCACCGTGGCCTTGACATGACTACCCTAATTCTAAGATGAAGCAGAGCTTGAGAATCACTAAGCTAGGTAACTTCTGGGCTTCAGTTCTTCATCCAGAAAATGGATCATTACTTTTATGAACATAAATGCATATATAAAATATTGAAGTTTATATAGTTGAATACTATTTAATATTTACTTGTTT