Transcript asmbl_20519

Sequence
Transcript Sequence for observation asmbl_20519 of TGE0004192:
CGGAGCGCAGCTGTGAGGGAGTCTGTCTGGTCCGCGGCCCCAGAACCCGAGCTGAAGCGGTAGCGCAGGCTGCGGGAAGCTGAGTCGGAAGGCCTGAGTGTTTGTTCAAGCATGTCGGAAGGGGAGTCCCAGACAGTACTCAGCAGTGGCTCAGACACAAAGGTAGAATCCTCATCTTCAGCTCCTGGCCTGACATCAGTGTCACCTCCTGTGACCTCCACAACCTCAGCTGCTTCCCCAGAGGAAGAAGAAGAAAGTGAAGATGAGTCTGAGATCTTGGAAGAGTCACCCTGTGGGCGCTGGCAGAAGAGGCGAGAAGAGGTAAATCAGCGGAATGTACCAGGTATTGACAGTGCATACCTGGCCATGGATACAGAGGAGGGTGTAGAGGTTGTGTGGAATGAGGTACAATTCTCTGAGCGCAAGAACTACAAGCTGCAGGAGGAAAAGGTCCGTGCTGTATTCGATAATCTGATTCAATTGGAACATCTCAACATTGTTAAGTTTCACAAATATTGGGCTGACATTAAAGAGAACAAGGCCAGGGTCATTTTTATCACAGAATACATGTCATCTGGGAGTCTTAAGCAATTTTTGAAGAAGACCAAAAAAAACCACAAGACTATGAATGAAAAGGCTTGGAAGCGCTGGTGCACACAGATCCTCTCTGCCCTAAGCTACCTGCACTCCTGTGACCCCCCCATCATCCATGGGAACCTGACCTGTGACACCATCTTCATCCAGCACAACGGACTCATCAAGATTGGCTCTGTGGCTCCTGACACTATCAACAATCATGTGAAGACTTGTCGGGAAGAACAGAAGAATCTACACTTCTTTGCACCAGAGTATGGAGAAGTCACTAATGTGACAACGGCAGTGGACATCTATTCCTTTGGCATGTGTGCACTGGAGATGGCAGTGCTGGAGATTCAGGGCAATGGAGAGTCCTCATATGTGCCACAGGAAGCCATCAGCAGTGCCATCCAGCTTCTAGAAGACCCATTACAGAGGGAGTTCATTCAAAAGTGCCTGCAGTCTGAGCCTGCTCGCAGACCAACAGCCAGAGAACTTCTGTTCCACCCAGCACTGTTTGAAGTGCCCTCACTCAAACTTCTTGCTGCCCACTGCATTGTGGGACACCAACATATGATCCCAGAGAATGCGCTGGAGGAGATCACCAAAAACATGGATACCAGTGCTGTACTGGCTGAAATCCCTGCTGGACCAGGAAGAGAACCAGTTCAGACTTTGTACTCTCAGTCACCAGCTCTGGAATTAGATAAATTCCTTGAAGATGTCAGGAATGGGATCTACCCCCTGACAGCCTTTGGGCTGCCTCGGCCCCAACAGCCACAGCAGGAGGAGGTGACATCACCTGTGGTGCCGCCTTCTGTCAAGACTCCAACACCTGAACCAGCTGAGGTGGAGACCCGAAAGGTGGTGCTGATGCAATGCAACATTGAGTCAGTGGAGGAGGGAGTCAAACACCACCTAACACTTCTGCTGAAGCTGGAGGACAAACTGAACCGGCACCTGAGCTGTGACCTGATGCCAAATGAGAACATCCCTGAGTTGGCAGCTGAGCTGGTGCAGCTGGGCTTCATAAGTGAGGCTGACCAGAGCCGGCTGACTTCTCTGCTAGAAGAGACCCTGAACAAGTTCAATTTTGCCAGGAACAGCACCCTCAACTCAGCCGCTGTCACCGTCTCCTCTTAGAGCTCACTTGGGCCAGGCCTCTAATCTGAGCTGTGGCTGTCACTAGATATGCTGCAGCCTTCCTGCCCCTCCCCCCCAGTCAGTATTACCCTGTGAAGCCCCTTCTCTCCTTTATTATTCAGGAGGGCTTTGGGGCTCCCTGGTTCTGAGCATCACCCTACCCCTTCCCCTTTTATTCCTCCCCTCAGCACTTTGTTTACTTGTTTTGCACAGACGGGGGCCTGGGCCTTCTCAGCAGCCGCCTTCTAGTTGGGGGCTAGTAGCTGATCTGCCGGCTCCTGGCCTGCCTGTGTGGAAAGGGGGCCCACGGGCGCTGGGGGAGCCGAATTCTACAATCCCGCTGGGGCGGACGGGGCGGGAGAGAAGGGTGGTGCTGCAGTGGTGGCCCTAGGGGGCCATTCTGATT