Transcript asmbl_20321

Sequence
Transcript Sequence for observation asmbl_20321 of TGE0004164:
TATTAGGGTCCTAGCTGGGTTTCTCTGAGAGTGGGGACTTATGCCTCCCTCCCCTCTGGGGGAGGGAGGAATAGAAAGTCCCTCATCTCTTTGCTCGCCTAAGTAGAGACTGGTATCTCTTCTAAAGGGTGAGGTGGCTTTGAACCCGGGTTGCCCGGCCAGCGCGACCAAGGAGGTGGCTGGAGGACTGGAGAATGAACGGAGAAGCCGACTGTCCCACAGACCTGGAAATGGCCGCCCCCAAAGGCCAAGACCGCTGGTCCCAGGAAGACATGCTGACTTTGCTAGAATGCATGAAGAACAACCTTCCATCCAATGACAGCTCCAAGTTCAAAACCACTGAGTCACATATGGACTGGGAAAAAGTAGCATTTAAAGACTTTTCTGGAGACATGTGCAAGCTCAAATGGGTAGAGATTTCTAATGAGGTAAGGAAGTTCCGTACATTGACAGAATTGATCCTTGATGCTCAGGAACATGTTAAAAATCCTTACAAAGGCAAAAAACTCAAGAAACACCCGGACTTCCCAAAGAAGCCCCTGACCCCTTATTTCCGCTTCTTCATGGAGAAGCGGGCCAAGTATGCTAAACTCCACCCTGAGATGAGCAACCTGGACCTGACCAAGATCCTGTCCAAGAAATACAAGGAGCTGCCGGAGAAGAAGAAGATGAAATATATTCAGGACTTCCAGAGGGAGAAACAGGAGTTCGAGCGAAACCTGGCCCGATTCAGGGAGGATCACCCTGACCTAATCCAGAATGCCAAGAAGTCGGACATCCCCGAGAAGCCCAAAACCCCCCAGCAGCTGTGGTATACCCACGAGAAGAAAGTGTATCTCAAAGTGCGGCCAGATGCCACTACGAAGGAGGTGAAGGACTCCCTGGGGAAGCAGTGGTCTCAGCTCTCGGACAAAAAGAGGCTGAAATGGATTCATAAGGCCCTGGAGCAGCGGAAGGAGTACGAGGAGATTATGCGTGACTATATCCAGAAGCACCCTGAGCTGAACATCAGTGAGGAGGGCATCACCAAGTCCACCCTCACCAAGGCCGAACGCCAGCTCAAGGACAAGTTTGATGGGCGACCCACCAAGCCACCTCCGAACAGCTACTCGCTGTACTGTGCAGAGCTGATGGCCAACATGAAGGATGTGCCCAGCACAGAGCGCATGGTGCTATGCAGCCAGCAGTGGAAGCTGCTCTCCCAGAAGGAGAAGGATGCCTACCACAAGAAGTGTGACCAGAAAAAGAAGGATTATGAGGTGGAACTGCTCCGTTTTCTGGAGAGCCTGCCTGAGGAGGAGCAGCAGCGGGTGTTGGGAGAGGAGAAGATGCTGAACATCAATAAGAAGCAAGCAACCAGCCCAGCCTCCAAGAAGCCCTCCCAGGAAGGGGGCAAGGGTGGCTCAGAGAAGCCCAAGAGGCCCGTGTCGGCCATGTTTATCTTCTCTGAGGAGAAGCGGCGGCAGCTGCAAGAGGAACGGCCAGAGCTCTCAGAGAGCGAGCTGACCCGCCTGCTGGCCCGCATGTGGAACGACTTATCGGAGAAAAAGAAGGCCAAATACAAGGCTCGGGAGGCTGCGCTGAAGGCCCAGTCGGAAAGGAAGCCTGGCGGAGAGCGCGAGGAACGGGGCAAACTGCCCGAGTCACCCAAGAGAGCAGAGGAGATCTGGCAACAGAGTGTCATTGGCGACTACCTGGCTCGCTTCAAGAATGACCGGGTGAAGGCCTTGAAAGCCATGGAGATGACCTGGAACAACATGGAGAAGAAGGAGAAACTGATGTGGATTAAGAAGGCGGCAGAAGACCAAAAGCGATATGAGAGAGAGCTGAGTGAGATGCGGGCACCTCCGGCTGCTGCAAACTCATCCAAGAAGATGAAGTTCCAGGGAGAACCCAAGAAGCCTCCCATGAACGGTTACCAGAAGTTCTCCCAGGAGCTGCTGTCCAACGGGGAGCTGAACCACCTGCCGCTGAAGGAACGCATGGTAGAGATTGGCAGCCGCTGGCAGCGCATCTCTCAGAGCCAGAAAGAGCACTACAAAAAGTTGGCAGAGGAGCAGCAAAAGCAATACAAAGTGCACCTCGACCTCTGGGTCAAGAGTCTGTCTCCCCAGGACCGAGCAGCATATAAAGAATATATCTCCAATAAACGTAAGAGCATGACTAAGCTGCGAGGCCCAAACCCCAAGTCCAGCCGGACTACCCTGCAGTCCAAGTCGGAGTCTGAGGAGGAGGATGACGAGGATGAGGATGATGATGACGAGGATGAAGAGGAAGAAGATGATGAGAATGGAGACTCCTCTGAGGATGGCGGGGACTCCTCTGAGTCTAGCAGCGAGGATGAGAGCGAGGACGGGGATGAGAATGAGGATGACGATGAGGATGATGATGAGGATGATGATGAGGATGAGGATGAAGACAATGAGTCCGAGGCCAGCAGCTCCAGCTCTTCCTCCTCAGGGGACTCCTCAGACTCTGACTCCAACTGAGGCTGGGCCCCACCCGGGGCTCCCCTCCCCAACTGACCACCTTTGTTTCTCCCCCTTGTTCTGTCCCCTGCCCATGACCCACCCACCCCACTCCCCACCTCCTCCAATTTTTCTTTCTTTTTTTTTTAAACAATATGGTGGGGGAGGGGCTGGAGGAGCTCAGGCCAGGACTCTGCAGCCTCAGAGACATCAGCCCTGGGGGCCCTCCAGGGAGCAACCATCAGACTGAGCCACCACTGGACCGGCCCAGCCCACCCCTCTGCACTTGCGGTTCTGGCATGGACAATGGACCTGGGAGTGGGGTGGGGGGGTTCCCAAAGAGTTCAGTGAGGCCCGCTACACCTGCAGCCCAACCCAAGGGAGGGTGGAAGCTTGGGGAGGACCCCTGCCTTCCCAGAGAGGCTTGCCACCTGGACCCCTACATTGGAACTGGAGGCAGGGAACCTGGGGAGAGGAGGATGGGTGCCTATGAGAAAACAGGCGCTGCCCCATAGACCTCTCCCCTGCCCCCTGCAGGAAGGAACTGCCTGGACCCAGTCATGGGGGGAGGGGCAGAAGTGTTTTTTATATATGTGTATATATTTTTTTTTTAAGCTCTGAGCTGTCAACGAGACGTTTCCTACCGATATCGGCTGCCGTCTCTGTTGTCATTTCTGGGAGAGGGAGGGTTTAGGGGTAGGTTTGGGAATTTTTTAAAACCTGGTATGTATGGAAAATTGTGTGTGTGTGTGTGTG