Transcript asmbl_20293

Sequence
Transcript Sequence for observation asmbl_20293 of TGE0004161:
GTCGCAGGGCCCAACATCTGTACCACACGCGGTGTGAGCTCCTGCCAGCAGTGCCTGGCCGTGAGTCCCATGTGTGCCTGGTGCTCAGATGAGGCCCTGCCTCTGGGCTCTCCCCGCTGCAACCTGAAGGAGAATCTGCTGACGGATAACTGTGCCCTGGAGTCCATCGAGTTCCCCATCAGTGAGGCCAGCATCCTGGAGGCCAGACCCCTCAGTGACAAGGGCTCTGGAGACAGCTCTCAGATTACTCAAGTCAGTCCCCAGAGGATTGCGCTCCGGCTCCGGCCAGATGATTCGAAGAGTTTCTCCGTCCAGGTCCGGCAGGTGGAGGATTACCCTGTGGATATCTACTACTTGATGGACCTGTCTTACTCCATGAAAGATGACCTGTGGAGCATCCAGAACCTGGGTACCAAGCTGGCTTCCCAGATGCGCAAGCTCACCAGTAACTTACGGATTGGCTTTGGGGCCTTTGTGGACAAACCCGTGTCACCATACATGTACATCTCCCCACCAGAGGCCCTCAAAAACCCCTGCTATGATATGAAGACCACCTGTTTGCCCATGTTCGGCTACAAACATGTGCTCACACTGACTGACCAGGTGACCCGCTTCAATGAGGAGGTGAAGAAGCAGAGTGTGTCACGGAACCGAGATGGCCCAGAGGGCGGCTTTGATGCCATCATGCAGGCGACAGTCTGTGATGAGAAGATTGGCTGGAGGAATGATGCATCCCACTTGCTGGTGTTTACCACTGATGCCAAGACCCATATAGCACTGGATGGAAGGTTGGCAGGCATTGTCCAGCCCAATGATGGGCAGTGTCACGTTGGCAGTGACAACCATTACTCTGCCTCTACTACCATGGATTATCCCTCTCTGGGGCTGATGACTGAGAAGTTATCCCAGAAAAACATCAATTTGATCTTTGCAGTGACTGAAGAAGTAGTCAATCTCTACCAGAACTACAGTGAGCTCATCCCAGGGACCACAGTGGGAGTTCTGTCCACCGATTCCAGCAATGTCCTACAGCTCATTGTTGATGCTTATGGGAAAATCCGCTCCAAAGTAGAGCTGGAAGTGCGTGACCTTCCTGAGGAGTTGTCTCTGTCCTTCAATGCTACTTGTCTCAACAACGAGGTCATCCCAGGCCTCAAGTCTTGTGTTGGACTCAAGATTGGAGACACGGTGAGCTTCAGCATCGAGGCCAAGGTGCGTGGCTGCCCCCAGGAGAAGGAAAAGTCCTTCGCCATCAAGCCTGTGGGCTTTAAAGACAGTCTCACTGTGCAGGTCACCTTCGACTGTGACTGTGCCTGCCAGGCCCATGCCGAGCCTTACAGCCGCCACTGCAACAACGGCAATGGGACCTTTGAGTGTGGGGTGTGCCGCTGTGGGCCTGGCTGGCTGGGATCCCAGTGTGAGTGCTCAGAAGAGGACTACCGCCCCTCGCAGCAGGATGAGTGCAGCCCCCAAGAGGGCCAGCCAGTCTGCAGCCAGCGGGGCGAGTGCCTCTGTGGCCAGTGCGTCTGCCACAGCAGTGACTTTGGCAAGATCACGGGCAAGTACTGTGAGTGTGATGACTTCTCCTGTGTCCGCTACAAGGGGGAGATGTGCTCGGGACATGGCCAGTGCAGCTGTGGGGACTGCCTGTGTGACTCCGATTGGACCGGCTACTACTGCAACTGTACCACACGCACGGACACCTGCATGTCCAGTAATGGGCTGCTGTGCAGCGGCCGGGGCAAGTGTGAATGTGGCAGCTGCATCTGCATCCAGCCAGGCTCCTACGGGAACACCTGTGAGAAGTGTCCCACCTGCCCTGATGCCTGCACCTTTAAGAAGGAGTGTGTAGAGTGTAAGAAGTTCAACCGGGGAACCCTGCTCGAGGAAAATACCTGCAACAGTTACTGTCGTGATGAGATCGAGTCTGTGAAGGAGCTCAAGGACACTGGCAAGGATGCAGTGAATTGTACCTATAAGAATGAGGATGACTGTGTCATCAGGTTCCAGTACTATGAAGACTCCAGTGGAAAGTCTATCCTATATGTGGTAGAAGAGCCAGAGTGTCCCAAGGGCCCCGACATCCTAGTGGTCCTGCTTTCAGTGATGGGGGCCATTCTGCTCATCGGCCTTGCTACTCTGCTCATCTGGAAGCTCCTCATTACCATTCATGATCGGAAGGAATTTGCAAAATTTGAGGAAGAGCGAGCCAGAGCAAAATGGGACACGGCCAACAACCCACTGTATAAAGAAGCCACATCCACCTTCACCAACATCACCTACCGGGGCACTTAATGGCAAAGTAGTCGTCCTCCGATCACTATCAGACTGTCCCAGGATTGTGGGCATCTCTGCTGTCGTGTTTACAGGAGACAATATCTGTGGGGTGGGATTGGGGGCTTGGAGTGGGGTGGGTTGGGAGAATGTCAGTGAGTGGAAGTGTGGGTCTCTGTGCATGTGTGCGTGTGAGTGTGCTGCGTGAGGGGGAATGTATAATTTAAAGCTTGTCACGTGTCCTGGATAAGCAGAGCTCCTCAGCCTTTGTCCTCAGAACACCTCACATTCTTCCTGCTTCACCTCCTGAAGATGACCTAGGTAGCTGAGTGGGTGTTCTTCATTACCTCAGTGAGAAGCCAGCTTTCCTTCACGGGCCATTCTCCCTGAAGAGAAGGGCAGCGCTGAGGCCTCTTGTTCCAGAAAAAGAGACCCAGACTCTATCCTGAGTTTATGGTTCTTGAGCCTGACTCTCAGCAGCTATGGTAGAAACTGCTGGGTTTTGCAGCCTTGTTGTGTCATCTGTACCTCTATCTCCTTCCCTTTCCCTCAGGCTGAAGGAGAAATCAGGGGAGAGTTGAACCATCAGAGTCTGTGCCTTTTCCATCACCTTAGTCCAGCATGGTTCTCTCATAGGGGGAGTCCTTGCTACTTAATTCTTTGATCTGTTGCAAGAGATGATGGCAGGGCCACTCGGGGGCCACGCATGGCTTGGGAGAATGTGCTAGGGCCCCCCCGTTCATAATCATCACCCTTCAGATTTGCCCCATTGGCAGCTCCACCCTAGAGATTTGTTTAGATATGTTTCACCCTTAGACCAGCACCACTTCTTACCTCCTACTCCCACGCTCTCACTGCTGTTGACATTTACTACATGACTGAAAGCTTGGCCTCTGAGGGAGGGTGCTATGGTTAGAGCCAGGGGTCTGGCCCGCCCTTCAGGCCTTCTGCCCCTTGTCCAAGACACCACCGCACATCCAATCTTGTGCTTCTATGTGCTGTGTCCATCTATGGGGCCAACTGCATTTATCTACCTCTGGGATGTCTTGTGAAGGAGTCATTCCCACGGTCTCCGAGTCTGCTGGGCATAAGTGCCAGGGTAGAATGATGGGCCAGTTGTATCAGCCTGTGTGGCCTTTTCTCTTGTGGGCTGGGCAACCTCATTTTAACTCAGTCATTAATCTGAGAGGCCACAAGTACAGTTTTATTTTATTTTTCTCATTGGGGCACCTGAAACCATGATGAGGCTTACTTAAACCAAAGGATATGTATAGAAACACACTTGTATTATATTTGTAATTTTATCTGATGACAAAGAAGGAGAGGAGGAAAAATCCACACAGACTTAGGCTGGATACAGACAGCCCTACTTAGCATCATTCATAGCTCATGATTGCCCGGTCATGGGCTCTGTCATCCTGGATGTCTGTGGCGATGGGTGCATGGACATGCTGGACTTTTCCCTGAGGGGGAGGGAAAGTGGCTATTCTTTTTTTCTAACAATAGCAGTGACTCTATTGGTGTTTCCATTCATTCAACATTAACAAACACCCCCAACCTACAAGAAAAAAGGAAGGGCCTATAAACAGTGGTCTGATGATCAGAAAATCTAAGTCCTGGCCTCATTGTTATAGCTAAGGAATCTTTAACCTTAATTAAAGCAAGTCACTTTCTTTTCCCTGAGGCTCAGTTTTTCTAGTTTGAAAAATGATGGGTTTGGACCAGCCAATCTAGAAGGTCTCTTTCAGTGTCAGCATTCTAAGATGCTGGGACTTGCTGTGATATTGAACATGCAATGAAGATTTTGTGGGATGTTGATATTGTTTGTGTTTTTAGATGGCAGATCTGAAAGACCTGGCTTTGGCAAGAGCAGATGTCATTCCATATCACCTTTCTCAATGAAAAAAAACCTCATTCTATCCTGTCTTAGAGCCCCTTCTCCAACTTTTGTTAGCAGTTACATCTCCTGATGTAGCACTTAAGCTCCAATAAGTTCTTATATCTTAGTTCACTTTGCACTCATTTGCACACACATATTAGAGAGGAGAAATCCAAAAGAAGTAGCTGAAATGTGTATCCTGTATCCAGGTGCTAACCTTGAGAGTAAGCCTTGGAATTAGGAATGGGGCAAATGACCGAGCCCTGTCTCACCATGGATTACCCTTTACTGTAGGGGATGGTAATGTAGTGTGAGGATAAAAAGGGAATGGGGAGGGATGATAAGGAATCCAAGAAGTTTAGAACCTAACTATAACCTTTGGCTACTGAGACAAGAGTCCATTAGCATAGTAGTTGGACTTTAGATAGGATGGCTTATATGAAGAGACTATATCAAAGGAGGAAGAATGGGTATGTAAAAGATGAAGACATCAGTAGGAATCCTGTCTGAGCTTCTGGAACGGGGCTCATAGGCATTGAAGCCAGTGCTGTCTGTATGTGGGGAGAACCTATAGCTGAGTTCAGGACAGAACAAACAGCAGTCAGTTTTGGCATCATGTGGGGTGAACATCTAAATAGTATTTTGGCATCAGAAAATATAGCCCAAAGAGATTATTTGTGCCCTGGTCTGCGGCACAAATCTCAGGGTCTGCGGACAATAATGGGAAGCTTTGAACATTCCTGAGAAGTTGTCATACAAGGAGTCATGTTCTTTACTTTTCAGATATTCCTAGACCATCCAAGATTTCAAGAGACTTCTCTTTGTTAAGTATTCCTGGTTGAAATGACCTAAGTGCCTTTCTGACTTCCTAACCACCTCCTCTGTTTGAGTTGTGTAACAGTGAATTAAATGTGTTTTCCAAAAAGAATTGGCCTAAGGCTGCCTAGTGCTTCCTGTGTTATTTCTGTTTCTTTTGGGTGAAAAGAATAAGTGTTATTGCCTCACAAATGATTATTTTAGGACAAGCAGGTTTCCAAATCTAACAGAATGATGACTACTATGGGAATTCAAGTTAGCTTCAGAACTTACAGCTTTTCTTTAGACTTTAATAACCTTTTCAAAATGAGTAAGTTATTACTGTTCTAAGAGTTATTCT