Transcript asmbl_19540

Sequence
Transcript Sequence for observation asmbl_19540 of TGE0004130:
GTTGACTGAAGCGAGCGAGCCGGGCTCCAGAGCGTCGAGGCGGAATCTCGGGCCCCCTGGAGTTGCAGCGGCTGCTCTGAGGCCAGCGCAGACATGGCTCACCTCAGGGGCTTCGCCAACCAGCACTCACGCGTGGACCCCGAGGAGCTCTTCACCAAACTGGACCGCATCGGCAAGGGCTCCTTCGGGGAGGTGTTCAAGGGCATCGACAACCGCACCAAGGAGGTGGTGGCCATCAAGATCATCGACCTGGAGGAGGCCGAGGACGAGATCGAGGACATCCAGCAGGAGATCACTGTGCTCAGCCAGTGCGACAGCCCCTACATCACCCGCTACTTCGGCTCCTACCTCAAGAGCACGAAGCTGTGGATCATCATGGAGTACCTGGGCGGCGGCTCCGCGCTGGACCTGCTGAAGCCGGGCCCCCTGGAGGAGACCTACATCGCCACCATCCTGCGGGAGATTCTCAAGGGCCTGGACTACCTGCACTCAGAGCGAAAGATCCACCGAGACATCAAAGGTCCCCGGGCTCGCCTCCTCTCCTGGCCCTCGAGCCCGCCAACCCTGGACAGGCCAGGGTGTGAGGTGGCAGGCGGCTGTGCGGGGCACGCGGCTGGTGGGGCTGGGGGCCTCGCAGCTCCGCGCTCCTGGCCTTTATCCCCTGCGGCCACCGGACACTGATGGCAGAGACGCTGGCGCCACGCCCTCATGCACCGGGAATGCCAGCCGTCTCCTGCTGGGAGAGCCACCGCACTGTGGGTTGGCCCTGCCGAGTCCCTGGGGAGGGGTCAGGGCCACCTGCATGCTGGCGTGGAAGGCAGGCCCGGGGAGGGCCCCTCACGCTTGCGGGCGCCCCCGGCAGTGCCCTGGCCTGGGCCTGTCTCTGGGCCGTGGGGGGAGGCAAAGCTGAGTGAGGCTCCACCAGCAGGTGCTGCTTCAGGCAGCTGCTCGCGGTGGGGTCTCCCTGGCTCAGAGCATGATGCCTCGCTGTCCTGTATCAAGCAGCTGCCAATGTGCTGCTCTCGGAGCAAGGCGACGTGAAGCTGGCGGACTTCGGGGTGGCAGGGCAGCTCACGGACACGCATATCAAGAGGAACACGTTCGTGGGCACCCCGTTTTGGATGGCGCCCGAGGTCATCAAGCAGTCAGCCTACGACTTCAAGGCTGACATCTGGTCACTGGGGATCACGGCCATTGAACTGGCCAAAGGTGAGCCTCCGAACTCTGACCTCCACCCCATGCGCGTCCTGTTCCTGATCCCCAAGAACAGCCCGCCCGTGCTAGAGGGCCACCACAGCAAGCCCTTCAAGGAGTTTGTGGAGGCCTGCCTCAACAAGGACCCCCGATTCCGGCCCACGGCCAGAGAGCTCCTGAAGCACAAGTTCATCACGCGCTACACCAAGAAGACGTCCTTCCTCACCGAGCTCATCGACCGCTACAAGCGCTGGAAGTCTGAGGGCCACGGCGAGGAGTCCAGCTCAGAGGACTCTGACATTGATGGGGATGCTGAGGATGGGGAGCAGGGCCCCATCTGGACGTTCCCCCCCACCATCCGGCCAAGCCCGCACAGCAAGCTGCACAAGGGGTCAGCGCTGCACGGCCCCCAGAAGTCTGCTGAGCCTGCCAAGAGGCAGCCGAGGTCCCAGTGCCTGTCCACGCTGGTCCGGCCTGTCTTCGGAGAGCTCAGAGAGAAGCACCGGCAGAGCGGTGGGGGCGTGGGGGCGCTGGAGGAGCTGGAGAACGCCTTCAGCCTGGCCGAGGAGTCCTGCCCCGGCATCTCGGACCAGCTGATGGCCCACTTGGTGGAGCGGGTGCAGCGGTTTTCACACAACAGAAACCACCTGACGTCCAGCCGCTGAAGCCGCCGTGGACGGGGAGCGGGCAGGGTGGCCTTCGTTTTGAGCTCTGTAGGGTCCTCGCTGACTTGGAGCCCTTTGCACCGTGTCACGGCCTCACCGCTGGGTCTCAGCCCCTACCCTGTGCGGAGGGCTGTCCCCCGTCCCTTCCTGGCTGGGCTGAGGTTACAGCTGGCAGCAGAGACCCCCTGGAGAACCAAGTGACCCTGTGGGGGCAGCGGGCTCGGTCCCCTCAGGCCTCCTTGGCAGGGCCGTCCCCTCCCCCAGGCTCACTGGGTGCAGCTGCTTGGATGGGGGTGTGGAGCCTGTCAGCCCAGCCCTTCCCTTGCCCAGGGCCATAGTGGCCGTGGATTTGCCTTGTGGTGTGAGACCAGGTGCCGTGTCTTCTCGTAAGCGCACGCGTCAGCCAGAACATTTTGTATTTTAAGAAAACTGAACTCTGCTTTCCTGTATCTTCCGAAGTTAAGGTGTTGGTCTCACGGGACGTGGAGAGGCTCCTGCCCCTTTCAATAAACACCTGAATTGAGCTGCACTGGTGGTG