Transcript asmbl_19539

Sequence
Transcript Sequence for observation asmbl_19539 of TGE0021035:
GTTGACTGAAGCGAGCGAGCCGGGCTCCAGAGCGTCGAGGCGGAATCTCGGGCCCCCTGGAGTTGCAGCGGCTGCTCTGAGGCCAGCGCAGACATGGCTCACCTCAGGGGCTTCGCCAACCAGCACTCACGCGTGGACCCCGAGGAGCTCTTCACCAAACTGGACCGCATCGGCAAGGGCTCCTTCGGGGAGGTGTTCAAGGGCATCGACAACCGCACCAAGGAGGTGGTGGCCATCAAGATCATCGACCTGGAGGAGGCCGAGGACGAGATCGAGGACATCCAGCAGGAGATCACTGTGCTCAGCCAGTGCGACAGCCCCTACATCACCCGCTACTTCGGCTCCTACCTCAAGAGCACGAAGCTGTGGATCATCATGGAGTACCTGGGCGGCGGCTCCGCGCTGGACCTGCTGAAGCCGGGCCCCCTGGAGGAGACCTACATCGCCACCATCCTGCGGGAGATTCTCAAGGGCCTGGACTACCTGCACTCAGAGCGAAAGATCCACCGAGACATCAAAGCTGCCAATGTGCTGCTCTCGGAGCAAGGCGACGTGAAGCTGGCGGACTTCGGGGTGGCAGGGCAGCTCACGGACACGCATATCAAGAGGAACACGTTCGTGGGCACCCCGTTTTGGATGGCGCCCGAGGTCATCAAGCAGTCAGCCTACGACTTCAAGGCTGACATCTGGTCACTGGGGATCACGGCCATTGAACTGGCCAAAGGTGAGCCTCCGAACTCTGACCTCCACCCCATGCGCGTCCTGTTCCTGATCCCCAAGAACAGCCCGCCCGTGCTAGAGGGCCACCACAGCAAGCCCTTCAAGGAGTTTGTGGAGGCCTGCCTCAACAAGGACCCCCGATTCGTAAGGCTCCAGGCCCCAGTTCGTGGGCGGCCCACGGCCAGAGAGCTCCTGAAGCACAAGTTCATCACGCGCTACACCAAGAAGACGTCCTTCCTCACCGAGCTCATCGACCGCTACAAGCGCTGGAAGTCTGAGGGCCACGGCGAGGAGTCCAGCTCAGAGGACTCTGACATTGATGGGGATGCTGAGGATGGGGAGCAGGGCCCCATCTGGACGTTCCCCCCCACCATCCGGCCAAGCCCGCACAGCAAGCTGCACAAGGGGTCAGCGCTGCACGGCCCCCAGAAGTCTGCTGAGCCTGCCAAGAGGCAGCCGAGGTCCCAGTGCCTGTCCACGCTGGTCCGGCCTGTCTTCGGAGAGCTCAGAGAGAAGCACCGGCAGAGCGGTGGGGGCGTGGGGGCGCTGGAGGAGCTGGAGAACGCCTTCAGCCTGGCCGAGGAGTCCTGCCCCGGCATCTCGGACCAGCTGATGGCCCACTTGGTGGAGCGGGTGCAGCGGTTTTCACACAACAGAAACCACCTGACGTCCAGCCGCTGAAGCCGCCGTGGACGGGGAGCGGGCAGGGTGGCCTTCGTTTTGAGCTCTGTAGGGTCCTCGCTGACTTGGAGCCCTTTGCACCGTGTCACGGCCTCACCGCTGGGTCTCAGCCCCTACCCTGTGCGGAGGGCTGTCCCCCGTCCCTTCCTGGCTGGGCTGAGGTTACAGCTGGCAGCAGAGACCCCCTGGAGAACCAAGTGACCCTGTGGGGGCAGCGGGCTCGGTCCCCTCAGGCCTCCTTGGCAGGGCCGTCCCCTCCCCCAGGCTCACTGGGTGCAGCTGCTTGGATGGGGGTGTGGAGCCTGTCAGCCCAGCCCTTCCCTTGCCCAGGGCCATAGTGGCCGTGGATTTGCCTTGTGGTGTGAGACCAGGTGCCGTGTCTTCTCGTAAGCGCACGCGTCAGCCAGAACATTTTGTATTTTAAGAAAACTGAACTCTGCTTTCCTGTATCTTCCGAAGTTAAGGTGTTGGTCTCACGGGACGTGGAGAGGCTCCTGCCCCTTTCAATAAACACCTGAATTGAGCTGCACTGGTGGTG