Transcript asmbl_19526

Sequence
Transcript Sequence for observation asmbl_19526 of TGE0004126:
GGGAGGAGTTCATACAAGTGCGCAGTGCCAGCTGCAGCAGTACGGCCCTTTGGCGTTCATCCTTGGCGACAGGACGACCAAAAAGCTGACAGAACGCAGCAGAGTGATAACCGTCGATGGCAATATATGTTCCGGGAAGAGCAAGCTTGCGAAGGTGGTAGCGGAGAAGCTAGGCTTGAGGTACTTTCCTGAAGCCGGGATCCATTATGCGGACAGCACCACGGGGGACGGAAAGCCGCTCGACGTGGAGCTCAGTGGCAACTGCAGCTTGGAGAAGTTCTACGACGACCCGAAAAGCAACGACGGCAACAGTTACCGCCTGCAGTCCTGGCTGTACGCCAGCCGCCTCCTGCAGTACGCCGACGCCTTGGAGCACCTGCTGAGCACAGGACAGGGCGTCGTGCTGGAACGCTCCATCTTCAGCGACTTCGTCTTCGTGGAGGCCATGTACAGCCAGCACTTCATCCGGAAGCAGTGTGTGAACCACTACTACGAGGTGAAGAAGGTCACCATCCGGGAGTACCTGCCCCCCCACGTGGTCATCTACGTCGACGTGCCCGTTCCAGAGCTCCAGAGCCGGATTCAGAAGAAGGGAGACCCACACGAGATGAAGATCTCCGCCGCCTACCTTCAGGCCATCGAGAATGCCTACAAGAAAACCTTCCTCCCTGAGATGAGTGAAAAATGCGAGGTCTTAGTGTATAGTGCGAATGAAGCTCAAGATGCGGAAAAGGTGGTGGAGGATATCGAATACCTCAAGTATGACAGAGGGCCGTGGCTCAACCAGGACGACCGTACCTTCCACATTCTGCGGATGCTGGTTCAGAATAAGTTGGAGGTGCTGAACTACACAACCATCCCGGTCTATCTCCCAGAAATCACGATCGGAGCTCACCAGAGTGACAGAGTCTTCCAGAAGTTCGTCGAGCTGCCAGGCCGCAGGTACAGCCCCGGGTACAACGCGGACGTGGGTGACAAGTGGATCTGGCTGAAGTGACGGCACGGCCTCCGCCAGAGCCGCTCCGTGGGACGCAGACGCCCGGCCGGCCGACCCGCACACTGTGGCTTTAGAACTGGGGGGAGTAGACGGTCCGAAATCGCAGGGTGCGGCAGCGGCACAGAGCAGGTGCCCGCAGGGTCGTCGGGGTGGGGGGACCTCGCCACCTCACTGTGGAGTAAGCACCGTTGTCGCGAGGGGAGCGCGGTCTGCGGGAGAGACGGGCGCCACCGGCACAGCCCCCCCGGCTCCCCTCGCGCTGTCGGGCACGTTTGTATGTCGCTCCCTCAGACTTGGAGAAATACAGCAGCTTCT