Transcript asmbl_19114

Sequence
Transcript Sequence for observation asmbl_19114 of TGE0021022:
GTGAAGTTGGAGGGGCTCAGGGACGCGGTGCGGGCCGCGGTTTGTGGGCTGCGGGTGGTGACCAGCATCCTGCTGTCTGGCCCCGGTGCGGCTGTACTCGGCTGGATAGTGCGCAGCGGCAGCGACACGAACCCGGCGCGGACAGGGCGCCCGTGGCTGGGCCCATGGCCTCCTGCGCGAGCATCGACATCGAGGACGCCACGCAGCACCTACGGGACATCCTCAAGCTGGACCGGCCCACGGGGGGCCCCAGTTCAGAGAGCCAACGGCCATCTAACGCCTACAATGGGGACCTCAATGGACTCCTGGTCCCAGACCCCCTCTGCTCAGGTGATGGTACTTCAGCAAACAAGCCTGGTCTCCGGGCCATGCCACCTATTAACCTGCAGGAGAAGCAGGTCATCTGCCTTTCAGGAGATGACAGCTCTACCTGCATTGGGATTTTGGCCAAGGAGGTGGAGATTGTGGCCAGCAGTGACTCTAGCATCTCGAGCAAGGCACGAGGGAGCAACAAGGTGAAAATCCAGCCTGTTGCCAAGTATGACTGGGAGCAGAAATACTACTACGGCAACCTGATTGCTGTGTCCAACTCCTTCTTGGCCTATGCCATTCGGGCTGCCAACAATGGCTCAGCGATGGTGCGGGTGATCAGCGTCAGCACTTCGGAACGGACCTTACTCAAGGGCTTCACAGGCAGTGTGGCTGACCTGACCTTTGCACACCTCAACTCTTCACAGCTGGCCTGCCTGGATGAGGCAGGCAACCTGTTTGTGTGGCGCTTGGCTCTGGTTAATGGCAAAATTCAAGAAGAGATTTTGGTTCATATCCGGCAGCCAGAGGGTACACCACTGAACCACTTTCGTAGAATCATCTGGTGCCCCTTCATCCCTGAGGAGAGTGAGGATTGCTGTGAGGAGGGCAGCCCAACGGTGGCCCTGTTGCATGAAGACCGGGCTGAGGTGTGGGACCTAGACATGCTCCGCTCCAACCACAGCACCTGGCCTGTGGATGTCAGCCAAATCAAGCAGGGCTTCATTGTGGTGAAAGGCCATAGCACATACCTGAGTGAAGGGGCCCTCTCACCTGATGGGACTGTCCTGGCCACTGCAAGCCATGATGGCTTCATCAAATTCTGGCAGATCTACATTGAGGGGCAGGATGAGCCAAGGTGTCTGCACGAGTGGAAGCCTCATGATGGGCGGCCCCTTTCCTGCCTCCTATTCTGTGACAACCACAAGAAACAGGACCCTGATGTCCCTTTCTGGAGGTTCCTCATTACTGGCGCTGACCAGAATCGGGAGCTGAAGATGTGGTGCACAGTGTCCTGGACCTGCCTGCAGACTATTCGCTTCTCCCCAGATATCTTCAGCTCAGTGAGTGTTCCCCCTAGCCTCAAAGTTTGCCTGGACCTCTCAGCAGAATACCTGATTCTCAGTGATGTGCAACGGAAGGTCCTCTACGTGATGGAGCTGCTGCAGAACCAGGAGGAGGGCCGTGCCTGCTTCAGCTCCATCTCTGAGTTCCTGCTTACCCACCCTGTCCTGAGCTTTGGTATCCAGGTCGTGAGTCGCTGCCGACTGCGGCACACTGAGGTGCTGCCTGCCGAGGAAGAGAACGACAGCCTAGGGGCTGATGGGACCCACGGAGCTGGTGCCATGGAGTCTGCAGCTGGTGTGCTCATCAAGCTCTTCTGTGTGCATACTAAGGCTTTGCAAGATGTGCAGATCCGCTTTCAGCCACAGCTAAACCCTGATGTGGTGGCCCCGCTCCCTACCCACACTGCCCATGAGGACTTTGCATTTGGAGATTCTCAGCCTGAACTGAGCTCCGGGGGGCTGGGATCAGCTGCTCATGGCTCCCAGCCTGACCTCCGACGCATTGTGGAGCTGCCTGCACCTGCTGACTTCCTTAGTCTGAGCACTGAGACCAAGCCCAAGCTGATGACACCTGATGCTTTCATGACATCTAGCACCTCCCTGCAGCAGATCTCTGCATCCCCTAGTAATAGCAGCGGCGGCAGCAGCAGTGGTAGCAGCAGCAGCAGCAGCAGCTCCTCTCTTACAGCTGTGTCTGCCATGAGCAGTACCTCGGCTGTGGACACCTCCTTGTCCAGGCCCCCTGAGGAGCTGACCTTGAGCCCCAAGCTGCAGCTGGATGGCAGTTTGACAATGAGCAGCAGTAGCAGCCTGCAGGCAAGCCCACGCAGCCTCCTGCCCGGCCTGTTACCAGGTCCAGCTGACAAATTGACTCCCAAAGGGCCTGGGCAGGTGCCTACTGCTGCCTCTGGACTGTCCCTGGAGCTGCAGGAAGTGGAGCCCCTGGGGCTACCCCAGGCTTCCCCTAGCCGTACTCGCTCCCCTGATGTTATTTCCTCAGCTTCCACTGCCCTGTCCCAGGATATCCCTGAGATCGCGTCTGAGGCCCTGTCCCGTGGCTTTGGCTCCTCTGCTCCTGAGGGCCTTGAACCGGACAGTATGGCCTCAGCTGCTTCAGCACTACACTTGCTGTCCCCACGGCCACGGCCCGAGCTTGGGCCCCAGCTTAGCCTGGATGGAGGCCCTGGGGATGGGGATCGGCATAGTACCCCTTCCCTCCTGGAGGCAGCCTTGACCCAAGAGGCTACAGCCTCTGACAGTCAGGTCTGGCCAACAGCACCAGACATTACTCGGGAGACCTGCAGCAGCCTGGCAGAAAGCCCTAGGAATGGCCTTCAGGAAAAGCACAAGAGCTTGGCCTTCCACCGACCGCCTTATCATCTGCTGCAGCAACATGACAGCCAGGATGCCAGTGCTGAACAAAGTGACCATGATGATGAGGTGGCCAGCATTGCCTCTGCTGCAGCGGGCTTTGGCACCAAAGTTTCCACTCCACGGCTTCCTGCCAAGGACTGGAAGACCAAGGGATCTCCTCGGGCCTCACCTAAGCTCAAGAGGAAGGGCAAAAAGGATGATGGGGATTCGACTGCGGGATCCCGGCTCATGGAGCACCAGGTGACAGAGCCCCCTGAGGATTGGCCTGCAATAATTTGGCAACAGCAGAGAGAGCTGGCAGAGCTGCGGCACAGCCAAAAAGAGCTACTGCAGCGTCTGTGCACCCAGCTCGAAGGCCTGCAGAGTACCGTCACAGGCCATGTAGAACGTGCCCTCGAGTCCCGGCATGAACAGGAGCAGCGGCGGTTGGAGCGGGCACTGGCAGAAGGGCAGCAGCGGGGTGGGCAGCTACAAGAGCAGCTGACGCAACAGCTGTCACAGGCACTGTCTTCAGCTGTGGCTGGGAGGCTGGAACGCAGCATACGGGATGAGATCAAGAAGACAGTGCCTCCATGTGTCTCTAGGAGTCTGGAACCCGTGGCAGGCCAACTGAGCAACTCAGTGGCCACCAAACTCACAGCTGTGGAGGGTAGCATGAAAGAGAATATCTCCAAGCTGCTGAAGTCCAAGAACTTAACAGACGCTATTGCCCGAGCAGCTGCAGACACGTTACAAGGGCCAATGCAGGCTGCCTACCGTGAAGCCTTCCAGAGTGTGGTGCTGCCTGCCTTCGAGAAGAGCTGCCAGGCCATGTTCCAACAGATCAATGATAGCTTCCGACTGGGCACACAGGAATACTTGCAGCAGCTAGAGAGCCACATGAAGAGCCGGAAGGCACGAGAACAGGAGGCGCGGGAGCCTGTGTTGGCCCAGCTGCGGAGCCTGGTCAGCACACTGCAGGGTGCCACTGAGCAGATGGCAGCCACTGTGTCTAACAGTGTTCGGGCTGAGGTGCAACACCAGCTGCATGTGGCTGTGGGCAGCCTGCAGGAGTCAATTTTAGCACAGGTACAGCGCATTGTTAAGGGTGAGGTGAGTGTGGCACTCAAGGAGCAGCAGGCCTCCGTCACCTCTAGCATCATGCAAGCCATGCGCTCAGCTGCAGGCACACCTGTCCCAGCTGCCCACCTCGACTGCCAGGCCCAGCAAGCCCATATCCTGCAGCTGCTGCAGCAGGGCCACCTCAATCAGGCCTTCCAGCAGGCCCTCACGGCTGCTGACCTGAACCTGGTGCTGTATGTGTGTGAAACTGTGGACCCAGGCCAGGTTTTTGGGCAGCCACCCTGCCCACTCTCCCAGCCCGTGCTCCTTTCCTTCATCCAGCAGCTGGCCTCTGACCTTGGCACTCGAACTGACCTCAAGCTCAGCTACCTGGAAGAGGCTGTGATGCACCTGGACCACAGTGACCCCATCACTCGGGACCACATGGGTTCCGTCATGGCCCAGGT