Transcript asmbl_18939

Sequence
Transcript Sequence for observation asmbl_18939 of TGE0004064:
GGGCCTGGCCGCTCTAGCCTCGACCGGGGGAAGTCACTGTCCTTACCTTCAGCCGGAGCCCGCGCTTCGGTGGATGAGCCCGCTCGCCCTCCGCTCCGTCCCGCAGCTACCCACTGCCCGCCTGCCTCCCGCTATGGCCCTGCTGCACTCCAGCCGCGTCCTGTCCGGGGTCGCCGCCGCCTTCCACCCAGGCCTGGCGGCTGCGGCTTCCGCCAGAGCCAGCTCCTGGTGGGCCCATGTGGAGATGGGGCCCCCAGATCCCATCCTGGGAGTCACAGAAGCCTATAAGAGAGACACCAACAGCAAAAAGATGAATCTGGGAGTTGGTGCCTACCGGGATGATAATGGAAAGCCTTATGTGCTCCCTAGTATCCGGAAGGCAGAGGCCCAGATTGCTGCAAAAAATTTGGACAAAGAATACCTGCCCATTGGAGGACTTGCTGAATTTTGTAAGGCATCTGCAGAGCTAGCCCTGGGTGAGAACAGTGAAGTACTGAAAAGTGGCCGGTATGTCACCCTGCAGACCATTTCTGGAACTGGGGCCTTAAGGATCGGAGCCAGTTTTCTGCAAAGATTTTTCAAGTTCAGCAGAGATATCTTTCTGCCGAAACCATCCTGGGGAAATCACACACCCATCTTCAGGGACGCCAGCATGCAGCTACAGGGTTATCGATACTATGACCCCAAGACGTGTGGCTTTGACTTCACAGGTGCTGTGGAGGACATTTCAAAAATTCCACAGCAAAGTGTTCTTCTTCTGCACGCCTGTGCCCACAATCCCACAGGGGTGGACCCTCGCCCCGAACAGTGGAAGGAGATAGCAGCAGTGGCAAAGAAAAACAATCTCTTTGTCTTCTTCGACATGGCCTACCAAGGCTTTGCCAGTGGTGACAGTAACAAAGATGCCTGGGCCGTACGCCACTTCATCGAACAAGGCATTAATGTTTGTCTCTGCCAATCCTATGCCAAGAACATGGGCTTATACGGTGAGCGTGTGGGAGCCTTCACTATGATCTGCAAGGATGCTGATGAAGCCAAAAGGGTAGAGTCACAGTTGAAGATCTTGATTCGCCCCATGTATTCCAACCCTCCTCTCAATGGAGCCCGAATTGCCTCCACCATTCTAAACAGCCCTGACCTCCGAAAACAATGGTTGCAAGAAGTGAAAGGCATGGCTGACCGCATCATCGGCATGCGGACTCAGCTGGTCTCCAACCTCAAGAAGGAGGGGTCCTCCCACAACTGGCAGCACATCACCGACCAGATCGGCATGTTCTGTTTTACAGGACTAAAGCCTGAACAGGTGGAGCGGCTGATCAAGGAGTTCTCCATCTACATGACAAAGGATGGCCGCATCTCTGTGGCAGGGGTCACCTCAGGCAACGTGGGCTACCTTGCCCATGCCATTCACCAGGTCACCAAGTAATTTCCCTGGTGAGACAGAACAGAGACAACCTTCCAGTCGACCTCTGCTGTTGTGAGATTCACAGAGGAAGCAGGAGGGTGGACGGTGGTGAGCGGAATCATTTCTTTCAACCACAGTACTTAAAACTCAGCGTTTGAATGCGTTTCTCAGAAAAGAATGTGTAGAGAAATAGAAGCATCTGTGGCTGGTGTGTGGAACTTTGTGGCTGTAAACCAAACCCTCCCTCATCTTTGTATCTCCAGCTTTTCCGAAAAGAGTTTACATGTACAAGAAAGTCGTAGCCAAAAAATTTTATCAATCACACCATTGCAATATTTCAGAAGCTTTAATTGAAGCACCTTATGGTGTTGGTCTGGAATGAAAATACCACTTATTAGAGGCTTTGTGAGAAGACCTAGTTCTAACATTGTCAGCCTCCTGTTTGTCCTGTAATTGAGCAACCTTATCAACAGACCACATTACAGAAACTGTGTGTTTTGAAAACCAGCACGTCTATTGCCACTGCAGCAAGTTCGGGAGCGGGGGGAGATGCAATTTCCATTTTTATTTAAGAAAAAGAAAGAAGACTCTCCTTTTTAGTTCTTGCAGGCATTTTAATGTCCCTCTGTCCTCCCTTATCACTGTTGTTCTTTTTCTCAGGCACTAAGATCTATAACTAGCCTAGATTTTTATCCCTTCTACTGCTGGATTGACCGTCAGCTCCATCCTATAGCATATACTTATTTGAAGAAAAGAACATGATTTACTGCTCACCCCGTGCCCTCCCCTTTCTCGGTAAAGAATAGCAGAGAATAAGTAACTGCACTTATTTTGCCATCCCCTTCAGTGATTGTCTCCTGCGGGATGTCGCCTCTGCCCAGTTGGACCTAGTACCTTAATTCAGTGCTGTTGAGCAGTCACTCATCTCACGTCACGAGTCGGGCGATATGAGGTAGAACCAGGAAAGAAGTTATTCTGGGATTTGGTCTTAACCTTTGTGTGCTGCCAGCTGGGCTCAGGCTTCACCCTTTGGAAAGATATCCACCATCTGCTCTAATCGTGTAGACTTACTGCAGCCTGGTTTCTCTGTTACAATAAAGTTACCGTAGACCCGA