Transcript asmbl_1866

Sequence
Transcript Sequence for observation asmbl_1866 of TGE0004118:
CAGAGCCTGGCTCAGCTAGAGAATCTGTGCAAACAGCTGTATGAAACCACAGATACAACCACTCGACTCCAGGCAGAAAAAGCCTTGGTTGAATTCACCAACAGCCCTGATTGCCTGAGCAAGTGCCAGCTACTCCTTGAAAGAGGAAGTTCATCGTATTCCCAGTTACTGGCAGCTACATGCCTTACAAAGCTTGTATCACGCACAAACAACCCTCTACCATTGGAACAACGAATAGATATTCGAAATTATGTGCTCAACTACCTTGCCACTCGGCCAAAGTTGGCTACTTTTGTGACACAAGCACTAATTCAGTTATATGCCAGAATCACAAAACTGGGCTGGTTTGACTGTCAGAAGGATGACTATGTCTTCAGAAATGCAATCACAGATGTCACAAGGTTTTTACAGGATAGTGTTGAATACTGCATCATTGGCGTCACAATTTTATCTCAGCTAACCAATGAAATTAATCAAGCAGACACCACCCATCCTTTAACCAAGCACAGAAAAATAGCCTCTTCTTTCCGAGATTCATCATTATTTGACATCTTCACACTTTCCTGCAATTTACTAAAACAGGCTTCGGGAAAGAATCTAAACTTGAATGATGAAAGCCAGCATGGTTTACTCATGCAACTGCTCAAACTCACTCATAACTGCCTAAACTTTGATTTCATCGGCACTTCTACTGATGAGTCCTCAGATGACCTGTGCACAGTACAGATCCCCACCAGCTGGAGATCAGCATTCTTAGATTCTTCAACTCTGCAGCTGTTTTTTGACCTGTATCATTCCATCCCTCCTTCATTTTCACCCCTGGTATTATCCTGCTTAGTACAGATTGCCTCAGTTAGAAGATCCCTGTTTAACAATGCAGAGAGAGCCAAGTTTCTCTCTCATCTTGTTGATGGTGTTAAACGAATACTGGAAAATCCACAGAGTTTATCAGACCCAAACAATTACCATGAGTTTTGCAGACTACTGGCCCGACTGAAGAGTAACTATCAACTGGGAGAGTTAGTAAAGGTGGAAAACTACCCTGAGGTCATCCGATTGATAGCTAACTTCACAGTGACCAGTCTACAGCACTGGGAATTTGCCCCAAATAGTGTGCACTATCTCCTGAGCCTATGGCAGCGGCTGGCAGCCTCTGTGCCATACGTGAAAGCCACAGAGCCCCACATGCTGGAAACTTATACTCCTGAAGTCACCAAAGCCTACATCACATCCCGTTTGGAATCTGTGCATATCATATTGAGAGATGGACTGGAAGATCCTCTGGAGGATACAGGTCTGGTCCAGCAGCAGTTGGACCAGCTGTCTACAATTGGACGTTGTGAATACGAGAAGACGTGTGCGCTCCTCGTGCAGTTGTTTGACCAGTCGGCCCAGTCCTATCAGGAGCTGCTACAGAGTGCCAGCGCAAGCCCAATGGATATTGCAGTGCAGGAAGGGAGGCTGACATGGCTGGTTTACATCATTGGCGCAGTAATAGGTGGCCGGGTCTCTTTTGCCAGCACTGATGAGCAAGATGCTATGGATGGCGAGCTTGTCTGTCGGGTGCTCCAGCTGATGAACCTAACAGATTCTCGCTTGGCTCAGGCAGGCAACGAGAAGCTAGAACTGGCCATGCTGAGCTTTTTTGAACAGTTTCGTAAGATCTACATTGGGGACCAGGTGCAAAAATCCTCTAAGCTGTACCGACGACTCTCAGAAGTTCTGGGCTTAAATGATGAGACCATGGTCCTGAGTGTCTTCATTGGAAAAATCATCACCAACCTGAAGTACTGGGGCCGCTGCGAGCCAATCACCTCCAAGACGCTACAGCTTCTCAATGACCTCTCCATTGGATACAGTAGTGTAAGGAAACTAGTGAAGCTTAGTGCGGTACAGTTCATGCTGAACAATCACACGAGCGAGCACTTTTCATTTTTGGGTATTAACAATCAGTCCAACCTGACAGACATGCGGTGTCGGACGACCTTCTACACAGCACTTGGGCGTCTCCTCATGGTGGATTTAGGAGAGGATGAAGATCAGTATGAACAATTCATGCTTCCACTCACAGCAGCGTTTGAGGCTGTAGCCCAGATGTTTAGCACGAATAGTTTCAATGAGCAAGAGGCGAAGCGAACTCTAGTTGGCCTAGTAAGAGACCTGAGAGGAATAGCTTTCGCCTTCAATGCCAAGACCAGCTTCATGATGCTGTTTGAATGGATATACCCATCCTACATGCCAATTCTCCAGCGCGCAATTGAGCTATGGTACCATGATCCAGCCTGTACCACACCCGTGCTCAAGCTGATGGCTGAATTAGTTCATAATAGATCCCAGCGACTCCAGTTTGATGTCTCTTCCCCCAATGGCATCTTACTCTTCAGAGAAACCAGCAAGATGATAACAATGTATGGCAATCGCATCCTGACACTAGGAGAGGTCCCAAAGGATCAGGTCTATGCACTGAAGCTCAAGGGCATCTCCATCTGCTTCTCTATGCTGAAGGCTGCTCTCAGTGGGAGTTATGTCAACTTTGGAGTCTTCCGTCTCTATGGAGACGATGCCCTGGACAACGCTCTCCAGACCTTCATCAAGCTGCTCCTCTCCATTCCCCACAGCGACCTCCTGGACTACCCCAAGCTCAGCCAGTCTTACTACTCACTGCTGGAAGTCCTGACCCAGGACCACATGAACTTCATTGCAAGCCTGGAACCTCACGTCATCATGTATATTCTCTCTTCCATATCTGAAGGACTCACTGCACTTGACACCATGGTTTGTACAGGCTGCTGCTCCTGCCTGGACCACATCGTGACATACCTCTTTAAGCAGCTGTCACGTAGCACCAAGAAGAGGACAACACCCCTGAACCAGGAGAGTGACCGCTTTCTGCATATCATGCAGCAGCATCCAGAGATGATCCAGCAGATGCTGTCAACGGTGCTGAACATCATCATCTTCGAAGACTGTAGGAACCAGTGGTCTATGTCCCGACCGCTACTGGGCTTGATACTACTTAATGAAAAGTATTTTTCTGACCTAAGGAACAGTATCGTGAACAGCCAGCCACCAGAGAAGCAGCAGGCTATGCATCTGTGTTTTGAAAACCTGATGGAAGGCATAGAGCGAAATCTTCTCACAAAAAACAGAGACAGGTTCACCCAGAACCTGTCAGCATTCCGTCGAGAAGTCAACGACTCGATGAAGAACTCCACTTACGGCGTGAATAGCAATGACATGATGAGCTGACACCTCCTTGGAATCTACCTGTACAGAGCAGCGTCCCTTCGGTCTGGCCCAGAGGGGCGAACAATTACAAGGGAGAGGGCCTGGCTGATCCTGGCGCCCTTCTCCAGGGGTGTGGAGAAAATGGCAAAGGTCAACTAGCTGTTTCCCCAGGGAATAGGGGTGTGAGTGC