Transcript asmbl_17847

Sequence
Transcript Sequence for observation asmbl_17847 of TGE0004007:
CGGGATCGGCGGCGGTAGCAGCAGCATGGCCGCGCTCTACGGGGGTGTAGAGGGGGGAGGAACACGGTCCAAGGTCCTTTTACTCTCAGAGGATGGGCAGATCCTGGCAGAAGCAGATGGACTCAGCACAAACCACTGGCTGATCGGGACAGACAAGTGTGTGGAGAGGATCAATGAGATGGTGAACAGGGCCAAAAGGAAAGCAGGGGTGGACCCTCTGGTACCTCTACGAAGCTTGGGCCTATCTCTGAGTGGTGGGGACCAGGAGGATGCCGTGAGGATGCTGATGGAGGAGCTGAGGGACCGATTTCCCTACTTGAGTGAAAGCTACTTAATCACCACCGATGCCGCTGGCTCCATCGCCACAGCTACGCCAGATGGTGGGATCGTACTCATCTCTGGGACAGGCTCCAACTGCAGGCTCATCAACCCCGATGGTTCTGAGAGTGGCTGCGGCGGCTGGGGCCATATGATGGGGGACGAGGGTTCAGCCTACTGGATTGCACACCAAGCAGTGAAAATAGTGTTTGACTCCATCGACAACCTAGAGGCAGCTCCTCATGACATTGGCTACGTCAAGCAGGCCATGTTCAACTATTTCCAGGTGCCAGATCGGCTAGGCATCCTCACTCACCTGTATAGGGACTTTGATAAATGCAGGTTTGCTGGGTTTTGCCGGAAAATTGCAGAAGGTGCTCAGCAGGGAGATCCCCTTTCCCGTTATATCTTCAGGAAGGCTGGGGAGATGCTGGGCAGACACGTTGTAGCAGTATTGCCTGAGATTGACCCGGTCTTGTTCAAAGGAGAGATTGGTCTCCCCATCCTGTGTGTGGGCTCTGTGTGGAAGAGCTGGGAGCTGCTGAAGGAAGGTTTCCTATTAGCGCTGACCCAGGGCAGAGAGATCCAAGCTCAGAACTCCTTCTCGCTTCACCTTTTTTTTTATTCCTCTGCCCTGGGCGGGGCCAGCCTAGGGGCGAGGCACATCGGGCACCTCCTCCCCATGGACTACAGTCTCAATGCCATTGCCTTCTACTCTTATACCTTCTCCTAGGGGGCTGATCCTGGCTCTACCCACTCCTAAGCCCAGTGGACGTTGCGTGCTGGGAAGGAGGAGGCCTTTACTTCTTTCCCTTTTCTTACAAAGAGGAAAAACATATACAAGAAAATAAACGCACTTTACTCACTCCCC