Transcript asmbl_17526

Sequence
Transcript Sequence for observation asmbl_17526 of TGE0018139:
CGCCGCGGTCCAGTCCTTCTGCCTGCCCGCCTGTTCGCTAGTCCCTCCTGCCGCCCGCCTGCTGGGCAGGGCCGGCCCGGCCCGGCCCGGCCATGGAGTCCTACGATATCATCGCCAACCAGCCCGTGGTCATCGACAACGGTTCGGGAGTGATCAAGGCTGGCTTTGCAGGAGACCAGATTCCCAAATACTGTTTCCCAAACTATGTCGGGCGCCCTAAGCACATGCGGGTGATGGCTGGAGCCTTGGAAGGGGACCTCTTCATGGGACCAAAAGCAGAGGAGCACCGGGGGCTTCTGGCCCTGCGCCACCCCATGGAGCACGGCGTTGTGCGGGACTGGAATGACATGGAGCGCATCTGGCAGTATGTCTACTCCAAGGACCAGCTGCAGACCTTCTCCGAGGAGCATCCTGTCCTTCTAACGGAAGCCCCGCTCAACCCAAGTAAGAACCGGGAGAAGGCGGCAGAGGTGTTTTTTGAGACCTTCAACGTGCCAGCCCTGTTTATCTCCATGCAGGCCGTGCTCAGCCTGTACGCAACAGGACGCACAACAGGAGTGGTCTTAGATTCAGGGGACGGGGTCACCCATGCTGTTCCCATCTACGAGGGCTTTGCCATGCCGCATTCCATCATGCGGGTGGACATTGCCGGCCGCGACGTCTCCCGCTATCTCCGGCTGCTGCTGCGCAAGGAAGGCGTTGACTTTCACACCTCAGCTGAGTTTGAGGTTGTCCGAACCATCAAAGAGAAGGATGAGGCTCTGGAGACAGAGAAGGTGCAGTATACTTTGCCGGATGGCAGCATACTCGACGTGGGGCCAGCACGATTCCGGGCCCCTGAGCTGCTGTTCCAGCCGGACCTGGTGGGGGACGAGAGTGAGGGGCTCCATGAGGTGCTGGCTTTTGCCATCCACAAGTCCGACCTGGACCTCCGCCGGACACTGTTCGCCAACATTGTGCTTTCAGGCGGCTCCACGCTGTTCAAAGGCTTTGGGGACCGATTACTAAGTGAAGTGAAGAAGCTTGCACCAAAGGATGTCAAAATCAAGATCTCGGCCCCCCAGGAACGGCTGTACTCCACATGGATCGGTGGCTCCATCCTGGCCTCACTGGACACTTTCAAGAAGATGTGGGTCTCCAAGAAGGAGTACGAGGAGGATGGCGCCCGTGCTATTCATCGTAAAACCTTCTAGCGCCCAAGGAGAAAGGCAGTGTGCTGGGCGAGTGGGAAGAAAGGGGCCAGAGCCCCAACCCTGTCTGGTCTGGGCCCACATACACCAGGCCCAGGGTTCCCTGTGTGCCCTGAACCCCGGGAAGGCGGTACAGCATCTTCCCTGCAGCCCTCCCCTTTGCACACACACGCACACACAGTAACGTTTAGCTGCATGGGTGGGGGTCTTGAGCTGGAACATAGAAATTGATGTGCCCAGCCATAGGTGGTTCTGGGTGTCCCTTTGGCAGGGCCAGTTAGGGCTACGGTTCCTGGCTCTGATCCTTGGGGCTGCTTCTTCCCCAGGCTCCAAGGCTTGACCCCCGAATGCCCCCGTTTCCTCTGACAGGGTCCCTCCCAGGACGAGGGCACCCGGGTGCCTGTGTAATTAGCCTTGGGGAGTGGGATAGAGGAGAAGGTGTCCAGCAGCTCCCCACTGGTGCATCCTTGCTTCTCGTGCCATCTCATCTTCCTGACCCGACAGAGTAGCACAGAGGGCCAGCCACTCCTGGCATAACTGGCCTCCCACACTGTCCCCCTCATCTTCCTGAGTGGATGTCTTTGTGTAGGCTGAGTACTGAGCAGTCTGCTGTCCCCAGTGAGGGGGTCTGACATAGGGTTGCACCCCCTGGAGCCAGGGCAGCAGATGCTTGGGGTTTGGACAGCCAGTCTGTTGCGCTGTCCCTTTCACAGTGCTTCACTGCCTTGCTTCTCCCCTGTCCTTTACCCTGGGCAAGCGTTAGTGGTCTTCCCTTGTTGAGAGTCAGACCCAGAGGGGTGAGGGGAAAGATCTCCTGTCCCACCTCACCCACTGGGAGGGTCATTACCCTGGGCCAGGGCCCCTCCCCGTCCCAGGTATGTACAATAATTTAACACAGTTGCCTGAAGAAAACTTTTTTGTAAATCATTATA