Transcript asmbl_16851

Sequence
Transcript Sequence for observation asmbl_16851 of TGE0020918:
GACATAAAGAAGTTGCCCCAGGAAATGCTGAGCCAGCTGCAGATTACACAGGGCTTTGCGGCCTTAGAGAAGCTGGAGGAGGCCCTGAAAGCCCCCACAGATGCTGGCCACAGCCTGAACGAGCTGTCCTCCCGCTTTTACACCATCATTCCCCACAACTTCGGCCGCAAAAAGCCCCCGCCCATTGACTCCTTCAAGCTTCTGCAGACAAAGAAGGACATGCTGCTGGTGCTAGACACCGTCGTCAAGCTGGTCCAGACCCAGGAGGCAGCCCTCGAGGAAGAGGAGGTGGAGGATGTGCCACATCCACTGGACCGAGCCTACCGGCTCCTCAAGTGCCAGCTCCAGCTGCTAGACCAAGAGGAGCCTGAGTACAAGATGATACAAACCTACTTAGGAGAGACTGGCAAGTACTACGAGCGCCTTGGTCTGGACCATGTTTGGAAAGTGAACCGAGACGGGGAGATGAGCGAGAGTACCCCACCGCCCTCCCCTGCCATCACTCAGACTCGCAGTGAGAGAGATAAGCTCCAGGCCCACTCCAAGCTGGACAATTGGAAGCCACTGTGGCATGGCACCAACGTGGCTGTGGTGGCCACCATCCTCAACAATGGGTTCCGCATTACCAAAAGTCTTGTTAGTAAGAGCACCTACTTAGCCTTGGAGAACAGTAAGTCCACCGGCTATGGCAAGGCGCCCCTCAGGCCAAGCCCTGGGCGGTGTGGGGGCAGGAGGGTTGGGCCTGGTGTTTACCCAGTTTGTGGAGGATCGGGGAGAGGAACCCTAGCATGCTTACCAGCCACAAAGCTCAGTGGGGCGTCCCAGGGCTTGGGGGGTTTCGGGACAGCTTCTTTGCGAAGGCCACACAGCTGGGTGAGCATACCAACCAGACCTGGGAAGAGGTCAAAGAGGAGCCTTCAAGGTAAAGCAGCCAGGGGGCGTCACAGAGGCTGGGAGGCTCCCGCAGGTCAGGACCTCCAAGTGTGGCTGATAGTGAAGCTTAGAGCAAATGCCTCATGTGGCAGGGATGTGAGGGCCTGGAAAGATCAAGGGGGCCTTACCCAGAAAGCCATGAGGAGCCCATGTGGACCTGTGCAGAGCAGGATTTCAGTGGCTGCAGCCGTGGAGAGGGCGGCAGAGGCCAGAGGCTACAGGGAGGTGGTGCTGGCATCGGGCCAGATGTGGTGGGCACCC