Transcript asmbl_16663

Sequence
Transcript Sequence for observation asmbl_16663 of TGE0001731:
AGTGCCTTTCATCTGAGAAGTTCAAGGCACTTCGTAGAACTTCTGCCACACAGGCCGTGGGTCTTGCAGCACATTTGTAAGCAATGGCTGCCATCAGGAAGAAATTGGTGATTGTTGGTGATGGAGCCTGTGGCAAGACCTGCTTGCTTATCGTTTTTAGCAAGGACCAGTTTCCAGAGGTGTATGTACCCACAGTGTTTGAGAACTATGTGGCAGATATTGAAGTGGATGGAAAGCAGGTAGAGTTGGCTTTGTGGGACACAGCTGGGCAGGAAGATTATGATCGCTTGAGGCCCCTCTCCTACCCGGACACTGATGTTATACTGATGTGTTTCTCCATTGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAATGGACTCCGGAAGTCAAGCATTTCTGTCCCAATGTGCCCATCATCCTGGTTGGAAACAAGAAGGACCTTCGGAATGATGAGCACACAAGGCGGGAGCTAGCCAAGATGAAGCAGGAGCCGGTAAAACCAGAAGAAGGCAGAGATATGGCGAACAGGATTGGCGCTTTTGGGTACATGGAGTGTTCAGCAAAAACCAAAGATGGAGTGAGGGAGGTTTTTGAAATGGCCACGAGAGCTGCTCTGCAAGCCAGACGTGGGAAGAAAAAATCTGGGTGCCTTGTCTTGTGAAACCCTGCTGCAAGCACAGCCCTCATGCGGTTAATTTTGAAGTGCTGTTTATTAATCTTAGTGTATGATTACTGGCCTTTTTCATTTATCTATAATTTACCTAAGATTACAAATCAGAAGTCATCCTGCTACCAGTATTTAGAAGCCAAGCCAACCATGATTATTAATGATGTCCAGCCCACCTGACCCGCCGGGGGCCTTCTGACACCGCTCTAACAGCCCTCCTCTGCACTCCACCTGACACACCAGGCACTAATTCAAGGGATTTCTTAACTTCTTGCTTCTTTCTAGAAAGAGAAATGGTAACTTTTGTGAATTAGGCTGTAACTACTTCATAACTAACATGTCTTGCCTCTCATCTGTCAGCTGCAACGTATTCTGGTGAGTCACCACTTCAGAGCTTTACTCCTTAACAGATTGCATTGGCATAGCTCTGGAGTGGCCATCCAGTTTTTTCAAAATGGGCTCAGCCAGAAAGGCCCAAGTCCATGCAGCTGTGGCAAAGTTACAGTTCTGTGGTTTCATGTTAGTTACCTTATAGTTACTGTGTAATTAGTGCCACTTAATGTATGTTACCAAAAATAAATATATCTACCCCAGACTAGATGTAGTATTTTTTGTATAATTGGATTTCCTAATACTGATATTTGTCATCCCCACAGAAAGTGTATTGGTTTTTTAAAAAAGAAAGTGTATTTGAAAATAAAGTCAGATGGAAAATTCATTTTTTAAATTCCCGTTTTGTCAGTTTCTCTGATAAAAGATGACCATCTCACCTGTTTTCAGCCCCACATGTCCCAGTCCCCCTCCCCAGAGCTGGGCTAAGTAAGTAGGAATTTGGTTTCAAGCGCCCGAGGCACTCAGACACTTCTGAAGGTGGCACAACCTGTCTGGACCGCAGGGTCGGCCTCTAGTTCACAGTGCTTTCTCCTCACTGTATCTAGGTTCCCTCCCAGAGGAGCCACCAGTTCTCGTGGGTGGCACTGTGTTTCTCTCCTCTCCAGCTGACTAAACTTTTTTTCTGTACCAGTTAATTTTTCCAACTACTAATAGAATAAAGGCAGTTTTCTAAA