Transcript asmbl_16320

Sequence
Transcript Sequence for observation asmbl_16320 of TGE0001766:
GAGGAGAGCCGTGCGCAGCAGCGCATTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCCAGGACCCTGAAAATAAACAGCCGCTACTTTGCGAGCGTCTCTCCCTGGGTCTGCGTCATTTTCTCTGCCGCTTCGGGCCCGTTCAGACACCGAAGATCTGACTGTAGCCATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGCCCGACTGGTGGAGGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTTTCCAGTTTGTTTCTTCATCTCTTCCAGACATCTGTTATCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTTCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGTTACAACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGTGATCATGCGGATGAGCAGAAGTGCTATTCTTGTGGAGAATTTGGACACATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCACCTTGCCCGGGAATGCACGATTGAGGCCACAGCTTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGACAGAGGCTACTCCCAGGCCAGTGAGCTTTACTTGCTGTGTAAAAGAAGGAAAGGGGTGGAAAAAAAATCGACTTTCTGCATTTAACTACAAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGCGCCACTGGTGAATAGGGATTGATGAATGGGAAGAGCTGAGTCAGACCAGTAAGCCCATTGTGGGTTTTTTGAATATGTTCCCATGTAGGAGGTAAAAACCAGTTCTGGAAGTGTCTGTGAGCTTCCATAAATAACTTTTAATTTTAGCATAATAATGGCCTTGGATTATCTGACCTCAGTAGCTGTTAAATAACATCTGTATCAGGCCATACATAGAACGTACAGTTGAGTGGGAGTAAACAAAATAAAAAGACAAACGTGTGTTAATATCTATGCGAGAAAAATCGGGATAAAAGCCTAAACAGGAACAACTTCCTAGCATTGATGCTGGATAAGCAGATGGTGATGGCAAAAGTTTAGAACACATTTTTTTCAAAGACTAAATCTAAAATGCAGAGTAAACATCTATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAGTGCATTTTCACAAAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTTTCATTTGCTGTAATCAGTTTTTTAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAATGTAATTTTAAACTATCCAATAAAGCTGGAGGAGGAAGGGGAGTTTGACTAAAGTTCTTTTTGTTTGTTTTAAATTTTCATTGATGTATATAGTGCAAAATGCCATATTAAAGAGGGGAATGTGGAGTAC