Transcript asmbl_16316

Sequence
Transcript Sequence for observation asmbl_16316 of TGE0001880:
GTGGCAGTGACGGAAGTGGGAGCGGAGCCGGATTCTTGGCCATAAAGCCCGAGGCGGCGGTGGTGGCGGCGGCTTTGGAAGCTTGGAGAGCGACGAAGAGTCCGCTGAAACCGGAACTTGGACTTCTCTGCCCCTGTCCTCGCCTTGTAGTTCCTCTTCAGCGGGAGCCTTCGTGACGTGCCCGGCCCGAAGCCCCGTTCGGAGCGGCCGAGTTTGAAGGATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTTATCATCCTGGGAGATTCTGGAGTCGGTAAGACATCACTCATGAACCAGTATGTGAACAAGAAATTCAGTAATCAATACAAAGCCACAATAGGAGCAGACTTTCTGACAAAGGAGGTGATGGTGGATGACAGACTAGTTACAATGCAGATCTGGGACACGGCAGGACAGGAACGGTTCCAGTCTCTTGGTGTGGCCTTTTATAGAGGCGCAGACTGCTGTGTTCTGGTATTTGATGTGACTGCCCCGAACACATTCAAAACCCTTGATAGTTGGAGAGATGAGTTTCTCATCCAGGCCAGCCCTCGGGATCCTGAAAACTTTCCCTTTGTAGTGTTGGGAAATAAGATTGACCTCGAAAACAGACAAGTGGCCACGAAGCGAGCACAGGCCTGGTGCTACAGCAAAAACAACATTCCCTACTTTGAGACCAGTGCCAAGGAGGCCATCAACGTGGAGCAGGCCTTCCAGACGATTGCACGGAATGCACTTAAACAGGAAACAGAGGTGGAGCTGTACAATGAATTTCCTGAACCCATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCGGCAGAAAGCTGCAGTTGCTGAATGGGCAATGAGAGCAGAGCACAGAGTCCTTCACAAACCAAGAACACACTTAGGCCTTCCAACATAAATCCCTTCTCCTCTTCTAAACAAAGCATAAAGTGATTTCTCAGACGCAGTTGCCAAAAGAAACCCCACCAGACACACTCACCCCTCCATACAACACACATACAAATCTGATACAAGCAGACAGACTCCAGTCACAGGCCTGTGAGCTCTATCAGGGTCTGCCCACCTATCACATCAGCCCTCGTATAGCAGCATGACAGGCCAGCTGTAGAAATCGTTCTGGTGTTGGCATCGGAAGCTAATTCTTTTTGTCCACCAGAGAGGGAGAACTGTTTACAGTTAATCTATGTCGGATTGGTTATCTTAATTTTTTTTAATGGTCTTGTGGTCTTTTTACCCCATCCCCATTCCCCTCTTGTGAAGGCTACCACTTGGGAAGGCTGGTGCCCTATGCTTCATTACAGGCTCACACCCAGTCTGTTCAGGCTGAGTTTTGTATGTATCTGTTAATGCTTGTTACTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAATATATGCAACCAATTAAAAATGTATAAATTAGTGTAAGAAATTCTTGGATTATGTGTTTAAGTCCTGTAATGCAGGCATGTAAGATGGAGGGTTGAACACTGTCTGGATTGCAGAATGTTAGCAACTCAATTCAGAAATCCAGCTAGAGGCAGTATTCTGTACAGTAAACACAAGAATTATGTACACCTTTTATCAAAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCCAGGGGGAAAACTGTCTAGTTCCCTTCTGTATCTAAATTTTCCAAAAGGTTGATTTGCATAATACAGTGGTGAATGCAGTAGATAAATGGCTGTTGTTAAAATTCTTGTTTTTCCTTTTTTTCTTGCTCCACCCTTTGAAACTCCCCTATTAGATCAGCATCCTACTTATAAGAGGAAAAGGAAAATCCTAACAAATCTGTCCTAGTGATTTACCTTTGTTCTAGAAGGCGCTCTTTTCAGGGTTGTGGTATCCCTTAGGTTAGCAAACCTTTTTCTCCTTTTCCCCACCTCCCCAGTATTGCCCATTATTGATTAACCTGTTTCTTTGGTGTGGAATCCTGGCAGTTCTTCCCCCTTCCTAGGGTCTGCCCCTGCATTCTAGCTTGTTTAATGGAGCACTTCCCCCTTTCCCAAAGGTCTACATTCTAGGGTGTGGGCCAAGTTCTTTCTGTAAAGAGATGAACCTGATGCCAATAAAATGTAACAAGAGCAAAGATCATTGCCTTTGCCCTGTCTTTTTTTGTTCTTCCAGACCTTTGGCTCAGTAGACACCATGTTAGCTAATCATAACCAATGCTTTATCAAGCAAAATAGCCCTCCATAACTGCGCATGTTTGGTGCTTTGAGGCAGAAAGGCCTTCCCATGTCCAGTCCTGCAGTACTTGTCCTTACTTTGTTTCTATTTTTTATCTTAGTCACAGTATTGGAGAGGGGCGCACTCTGAATGGAGAACACATTATCTGTCCCCTTAGAGGAGCAGCCACAAACTACTGGTGACCTATGGACCCTGCACAGCCTCTGAGTGTAACTCAGCCTTAGTGTTGTGTTGCTTTTTAATTGGCGTAGTTCTGGATTTCACTGGAGAGGAAGATTTGGCAGCAGGGACCCTCTATTTTAGCATATATAACCCACCAGCTGAAACTTAATAGATGCCACCTAGAACTAATTTTATAAAATAGTGTTTCAGTCAGTAGGTGGATATAGGTTTTGCAGATGTCCCCTGATGGCTTAGCTCTTGGAGTCTACTTTACTACACTTTTTTACCTTTCCACTTCTAAGGATCATCAGTTGCTTTCTTTCCTTGTACTTACTCTTGAGTCATACTTAACACGTTAAAAATAGCATTCTTAGAAGCTTCTGACTACAACTCCACTGTGGCTAGTGGTGCATGGCCTAACTCTCTGGTCCCACTCCCTGAGCTAGACCTAATTGGTGTTGTATTTGGCTTCTAGAGAAGCAGAATCCTTTCCAGCTTGGGACACACTGACTGGGGCCATGGTTTATGAGCCTTGTGTGATGCTTATCCCTACAAACCAGGCTACTGTTTCTCTCTGATTATGTTCCTCTAGTCCTAACCATGATGGTGACATGAAAATGGACCTTTACCTCTGATCTCAACCATCGTCCTAAAACTGATGATCATCTGGACGTTAACTTGCTTTATCTTGAGAGAGAAGCTTGAATATAACCGTATAAGTTGCCCTGATCCCAATCATAGCTCATCCTAATTTTAAACTTGATCTTAAACTGACATTGACTCTGATCTTCACCCTCATCTTGTCACAATCATCCTAATTGGTCTCCTTTAAATGACTTAAATCTGACCCTAAACATAATCCTGACTTTGAAGTTAACATGGGACCCTACTTTGACAACATTACTCTCCAGCCTGGGACTAATCAGTCTAATAACCCATCAGCCCTTTGTCTGGCTGACCTTAATTTCATTGTGTATACCTAAATTGTACACATACACACCATGTTCATCTAAATTTGGTTTATCCACAGAAAGAAGTAATGGCTGAGACTGAATCTTCACTAATCCAGTACTTTTTTCCATATTCCTACTTAGATTCAGCATAAGCATGTGCTTTTGAGAGAGAC