Transcript asmbl_16146

Sequence
Transcript Sequence for observation asmbl_16146 of TGE0014907:
GTGATCACATAGAGGTATTAGAACCACTGATTTCTTTCCTCCTTTTCCCCACCAGAATCCCCTCTCTGCAGGTCTACAGGGAGCCTGCCTTACGGAAACTGTAGAGCTGTTGCAGGCAAAAGTGAGCTCCCTGGACCTTGCAGTTTTGGACCAAGTGGAGGCTCGGCTACAGAGTGTCCTGGGAAAGATGAATGAGATTGCCAAGCATAAAGCTTCTGTAGAGGATGCAGATACACAGAGCAAGGTGCACCAGCTATATGAAACCATACAGCGTTGGAGCCCCATCGCCTCCACCCTTCCTGAGCTGGTGCAGAGACTTGTCACCATCAAGCAGCTACATGAGCAAGCCATGCAGTTCAGTCAGCTCCTGACACACTTGGATACCACACAGCAGATGATAACTAGTTCCCTCAAGGACAATACCACCCTCTTGTCCCAGGTACAGACAACCATGCGTGAAAACCTGTCCACAGTTGAGGGGAATTTTGCCAACATTGATGAACGGATGAAGAAGCTGGGAAAGTGAGCCCCTTTGGAAGATGGAGAACAGGGGTAATGCCTACCCCTTTGAACTCTGTTAACAGCTTACATAGGGTTTCCCCTTAAATATAACTCGCGTATCCCCATCCCATTTGACACTAGGGACAAGGGTTCTTGCATGTGGGGTTTACATCCCTCCTCTGATGACTAGTGTGGTAGCTGGGGGATATTAGATGGTGGTGTCTCCTTGGGCCCCAGGGATGAGGACATGGGCTCAGCCACATGCCAGCTCACGTCTAATACTGCTTTGTCCAGTGTGGGGAAAGATTGGGTCCTGTCCTCCAGCACAGCTTCTGTGGCTGATTGTAACACTGTACAACTGTTTCTGACCATTAAATGCTGTTGTACTCTG