Transcript asmbl_16066

Sequence
Transcript Sequence for observation asmbl_16066 of TGE0003894:
CCGGAGCCGGGGGGCGCAGCTAGAGAGCCCCTGAGCGGCGGCGAGAGAGGATCGCACGGCCTCGAGGAGCCCAGGTCCGGCAGCCATGGCGGTGGAAGGAGGAATGAGATGTGTCAAGATCTTGCTCTACGTTTTTCTGGTGGCTTTTTGCGCCTGTGCAGTGGGACTGATCGTTGTGGGTATAGGGGCCCAGCTCGTCCTGAGTCAGACCATCAGCCAGGGGGCCACTCCTGGCTCCGTCTTGCCTGTGGTCATCATCGCAGTGGGTGCCTTCCTTTTCCTGGTGGCTATTGTGGGCTGCTGTGGGGCCTGCAAGGAGAACTACTGTCTTATGATCACGTTTGTTATCTTCCTGTCTCTTATTGTGCTGGTGGAGGTGGCTGCAGCCATTGCTGGCTATGTGTTTAGAGACAAGGTGATGTCAGAATTTAATAAGGACTTCCGGCAGCAGATGAAGAATTATCCAAAACAGAACCAGACGGCTTTGATCCTGGACAGGATGCAGGAAAATTTCAAGTGCTGCGGGGCAGCTAACTACACAGACTGGGAGACCATGCTTCTTGAGCCCAAAGGCCGAGTCCCTGACTCCTGCTGTATCAATGTCACTCAGGGCTGTGGGATTAATTACAATGTGAAGGAGATCTATACCGAGGGCTGTGTGGAGAAGATTGGGTTCTGGCTGAGGAGCAATGTGCTGGTGGTGGCTGCAGCAGCCCTGGGCATTGCCTTTGTGGAGGTCCTGGGAATTGTCTTTGCCTGCTGCCTTGTGAAGAGTATCCAAAGTGGCTATGAAGTGATGTAGGAGGTCTGGTCTCTTCAGCCCCTCTTCTAGGAGGGTGGGGTAATATACTCCATGTTTTTCAATTAAACGGATTATTTTTTCAGACCG