Transcript asmbl_16020

Sequence
Transcript Sequence for observation asmbl_16020 of TGE0020879:
CGTGTATTTCCCCCAAACACGACTCAGGAGCAAGTTTATCATGCATGTGCCATGCAGATTGTCAAAGATGTCCTTGCTGGCTACAATGGCACCATATTTGCTTATGGACAGACATCCTCAGGAAAAACACATACTATGGAGGGAAAGCTGCATGACCCTCAGCTGATGGGAATTATTCCTCGAATTGCCCGAGACATCTTCAACCACATCTACTCCATGGATGAGAATCTTGAGTTCCACATCAAGGTTTCTTACTTTGAGATTTACCTGGACAAAATTCGTGACCTTCTGGATGTGACCAAGACAAATCTGTCTGTGCATGAGGACAAGAACCGGGTGCCATTTGTCAAGGGTTGTACTGAACGCTTTGTGTCCAGCCCAGAGGAGATTTTAGATGTGATTGACGAGGGGAAATCAAACCGTCATGTGGCTGTCACCAACATGAATGAGCACAGCTCTCGCAGCCACAGCATCTTCCTCATCAACATCAAGCAGGAGAACATGGAGACTGAGCAGAAGCTCAGTGGGAAGCTGTATCTGGTGGACCTGGCTGGGAGCGAGAAGGTTGAGGATCTTGTGGGGGTGGGATGGGGAGGGAAG