Transcript asmbl_15227

Sequence
Transcript Sequence for observation asmbl_15227 of TGE0003840:
CAATAGGACTTCCGGAAATCTGTGCCGGAGCACCCCTGCTTCCTAATCAAAGGTCTTGCGAACACAGACCAGGACGCCGCAGGTTCTTTCTCCGCTGCCACCGCTCGCAAAGCTTTCCCGACCGACATGCCGTTCGTTGAGCTGGACACGAACTTGCCCGCCAACCGCGTGCCCGCGGGGCTGGAGAAGCGGCTTTGCGCAGCCAGCGCCGCCATCCTAGGCAAACCCGAGGACCGCATGAACGTGACGGTGCGTCCGGGCCTGGCTATGGCGGTGAGCGGCTCGGCCGAACCCTGTGCTCAGCTACTTGTCTCCTCTATCGGTGTAGTGGGCACTGCCGAGGATAACCGCGGCCACAGCGCCCGCCTCTTTGAGTTCCTCACCAAGGAGCTGGGACTAGGCCAGGAACGGATAATTATCCGCTTTTTCCCCCTGGAGCCCTGGCAGATTGGCAAGAATGGGACAGTCGTGACATTTTTATGATTGGCATGGAAGACATCCGGGGTATCTGTGAGCTGGCCACCTCTTCCAGAGAGGCCTCCTGGCATAGTGAAGGCCTGGTTGATCCCAGCTTCTGGCATCCCCACATGCAGATATGTCTGTGACCTCACAGTCCTCTTCATCTCCATCCTTATTCCAAATAAATGAAGAGAGCTTTGTCTTTCAAA