Transcript asmbl_15183

Sequence
Transcript Sequence for observation asmbl_15183 of TGE0003834:
GTTGTTCCAGAGGTGGGAGGCGGCACCCGTGGCTGTGAAGGAGGCCTGAGAGCGACATGTCCCCGGCGGCTGAGGCAGAGCGGCCCGTGGCGCTGTTTGTCTGAGTCCAGGGCGGCCTGGCGGCCGGCTGAGGAAGAGGGTCGGCGGAGGCTGCCCCCGCTGTAGTGGCCGCCATGCTGGGGGCCCGGGCAGCTGAGGGAGTCGCCGTGGCGCTTCTGAGGCTGCTGCTGCTGCTGCTGCTGTCGGCGCTCCGGGGGCCGGGGCTCGGCGTGGTCGGCACGGCGGGGGCTGGGCTGTCGGACAGCGTTATTTGGGCGGTCAACGCGGGCGGCGAGGCGCATGTGGACGTGCACGGGATTCACTTCCGCAAGGACCCTTTGGAAGGCCGGGTGGGCCGAGCCTCTGACTATGGCATGAAACTGCCAATCCTGCGTTCCAACCCTGAGGACCAGATCCTATATCAAACAGAGCGGTACAATGAGGAGACCTTTGGCTACGAAGTGCCCATCAAAGATGAGGGAGACTATGTGTTGGTGTTGAAATTTGCCGAGGTCTACTTTGCACAGTCCCAGCAGAAGGTATTTGATGTGCGATTGAATGGCCACGTGGTGGTGAAGGACTTGGATATCTTTGATCGAGTTGGGCACAGCACAGCTCATGATGAAATCATCCCTATGAGCATCAGAAAGGGGAAGCTGAGCGTCCTAGGGGAGGTGTCCACCTTCACAGGGAAACTCTACATTGAGTTCGTCAAGGGTTACTATGACAATCCCAAAGTATGTGCACTCTACATCATGGCTGGGACAGTGGATGATGTACCAAAGCTGCAGCCTCATCCAGGATTGGAGAAGAAAGAAGAGGAAGAAGAAGAAGAAGAATACGATGAAGGGTCTAATCTCAAAAGACAGACCAATAAGAACCGGGTGCAGTCAGGCCCCCGCACACCCAACCCCTATGCCTCGGACAACAGCAGCCTCATGTTCCCCATCCTGGTGGCCTTCGGAGTCTTCATTCCAACCCTCTTCTGCCTCTGCCGGTTGTGAGGACAAATTACCATCCTGAACAGGGTGGAGGGTGTGGGAAAGAAACCAAACGTGTTGGTTTGGTTTCTGTATTTTTCATGGTGATTAACACACACACACACACACACAC