Transcript asmbl_13097

Sequence
Transcript Sequence for observation asmbl_13097 of TGE0020780:
TGCAGGTACGGGTTCATAGAAGGGCACGTAGTGATCCCCCGCATCAACCCTAACTCCATCTGTGCCGCAAACAACACAGGGGTGTACATCCTCACCTCCAACACTTCCCAGTATGACACGTACTGCTTCAATGCTTCAGCTCCGCCCGAAGAAGATTGTACATCAGTCACAGACCTGCCCAATGCCTTTGACGGACCAATTACCATAACTATCGTCAACCGTGATGGCACCCGCTACACCAAGAAAGGTGAATACAGAACTAACCCCGCAGACATCAACTCTAACTCTAGCAACTCCACTGAGGACGATATGAGCAGTGGATTCTCCAGTGAAAGAAGTACTTCAGGAGGTTACAGCATCTTCCACACCCACCTTCCAACTGCATACCCAACCCAAGACCAAGACAGTTTCTGGGTGTCCGACAATCCAGAGGAAGCCCCTACTACCAAAGACCAAGGCTCATCCCATGACCCCAGCGGGAGGGCCCATACCACTCATGGATCTGAATCAGCTGGACATTCAAGTGAGAATCGAGAAGGCGGGGCCAACACGACCTCTGGTCCTATAAGGAAACCTCAAATCCCAGAATGGCTGATCATCCTGTCATCCCTCCTGGCCCTGGCTTTGATTCTCGCAGTTTGCATCGCGGTCAACAGTCGAAGGAGGTGTGGGCAGAAGAAAAAGTTGGTGATCAACAATGGAAATGGAGCTGTGGAGGAGAGGAAGGCAAGTGGACTCAATGGGGAGGCCAGCAAGTCTCAGGAGATGGTGCATTTGGTGAACAAGGAGTCAACAGAGACCCCGGACCAGTTTATGACAGCCGATGAGACGCGGAACCTGCAGAATGTGGACATGAAGATTGGGGTGTAACACCTACACCGTGACCTTGGAAAAAAATGACACGTAACCATTACAGGGAGCTGGGACACTTCACAGATGCAATGTGCTACTGATAATTTCATTGGGGTTCTTTTTTAGCATAAAATTTTCTACTCCTTTTTGTTTTTTTGTGTTTTGTTTCTTAAAGGCAGTCCAGTTTATAAAAACAGCATTGCTTTCTGAAACGAGGGCCCAATTAACAATCGGTAAGAATTTGACTGTTCCAGTTCCCACCTAGAAGCCTCTCACTCCCTGGGGTGTGCTATAGATGACTTCTAACAAAACCCAACAAATCCATCTTCCCAGTTGACTCCCAACCTTCCTTCCACCCCACCTCCCAGGGGACAGCCACATGCTAAGGACATCTCCAAGGCTAAGAGGGATTGGTTCCTGGGAGGAAATTTGGATGGGTTCATTTTGCCCCTCCAGCGGCCCAATCCCTGGGCGTTGCTTTCCAGCGGGTATAGGGGATCGGGTGTACTGGTTATACATCCCTTTCCACAGATCCCCTGGAAATTTTTCAGATGCTTCTGGGAAATGCCCAAAGGGTGAAGCTATTTATCTGTAGTAAGCTATTTATCTGTGTTTTTGAATTGTTAAACCCTGGAGGTCCTTTGATCAGTATGATCTTTTTTTGTTTTGTTTTGTTACTTTGTCAGAGGCACAAAGGGGTTTAAGCTGATTCGTAATAAACATCTGTATTTCTTCTACTTT