Transcript asmbl_53238

Sequence
Transcript Sequence for observation asmbl_53238 of TGE0002767:
CACTTGCCCTCCCCGCTCGGAGCTGCCGCCTGGCTTGTCGCGGCTCTGCCACAGGGGCAGGTGTTGAGGGGCTCCCGGTCCGGCTGCCGCCGCTCCCCCGCTCCGGACCCGGGGCTCCCCCTAGCGCCGCTGAGGAGCCGCCTCTGCGGCTCCAGGAGGGCGCAGGAGCGGGACTGAGAGCGCCTGGAGGCTCGAGCGGAGGGTAATTCATTTGCACACCTGTTAGCAAGAAACAGAAGTTGAAGGACTGGAACAAGTGAACTAGGAAAGAGGGAACGCCAATCCAAGGATAGAAGGACAAGGACAGAATCACCAGCACTGGCTGAAGGTACCTTAACATGGGGAATCTTCTTAAAGTTTTGACATGCACAGACCTTGAGCAGGGGCCAAATTTTTTCCTTGATTTTGAAAATGCCCAGCCTACAGAGTCTGAGAAGGAAATTTATAATCAGGTGAATGTAGTATTAAAAGATGCAGAAGGCATCTTGGAGGACTTGCAGTCATACAGAGGAGCTGGCCACGAAATACGAGAGGCAATCCAGCATCCAGCAGATGAGAAGTTGCAAGAGAAGGCATGGGGTGCAGTTGTTCCACTAGTAGGCAAATTAAAGAAATTTTACGAATTTTCTCAGAGGTTAGAAGCAGCATTAAGAGGTCTTCTGGGAGCCTTAACAAGTACCCCATATTCTCCCACCCAGCATCTAGAGCGAGAGCAGGCTCTTGCTAAACAGTTTGCAGAAATTCTTCATTTCACACTCCGGTTTGATGAACTCAAGATGACAAATCCTGCCATACAGAATGATTTCAGCTATTATAGAAGAACATTGAGTCGTATGAGGATTAACAATGTACCGGCAGAAGGAGAAAATGAAGTAAATAATGAATTGGCAAATCGAATGTCTTTGTTTTATGCTGAGGCAACTCCAATGCTGAAAACCTTGAGTGATGCCACAACAAAATTTGTATCAGAGAATAAAAATTTACCAATAGAAAATACCACAGATTGTTTAAGCACAATGGCTAGTGTATGCAGAGTCATGCTGGAAACACCGGAATACAGAAGCAGATTTACAAATGAAGAGACAGTGTCATTCTGCTTGAGGGTAATGGTGGGTGTCATAATACTCTATGACCACGTACATCCAGTGGGAGCATTTGCTAAAACTTCCAAAATTGATATGAAAGGTTGTATCAAAGTTCTTAAGGACCAACCTCCTAATAGTGTGGAAGGTCTTCTAAATGCTCTCAGGTACACAACAAAACATTTGAATGATGAGACTACCTCCAAGCAAATTAAATCCATGCTGCAATAACAATTCTGGAATAAGCACCTGCTGTAGACAGAAGACAGTATTCTGCAATGACTGAGAATGCAGTTTTTTAGTGATTGCAATTACTATCTCATTTATTCTTGCTTTTATTTCTTTCCTCTGTTCCTCTTCCCTCTTTTTTAATCATGTTCTTAAGACTTCTTTTCTGTGCCAAAATCAGTAAAGTTACACTCTGAAGGGATATCATCCTTTCAAACGGGCCATCTAAGGCAGCTAATTATGCATTGCATTGGGGTCTCTACTGAGAAAAATTCTGTGACTTGAACTAAATATTTTTAAATGTGGATTTTTTTTGAAACTAATATTTAATATTGCTTCTCCTGCATGGCAAAACTGCCTATTCTGCTATTTAAAAACCCTCAATGACTTTATTTTCTACTGCCGCCTTTTTCATGTGCAACCAAAATGAAAATGTTTAAATTAACTGTGTTGTACAAATGGTACCCAACA