Transcript asmbl_12219

Sequence
Transcript Sequence for observation asmbl_12219 of TGE0003675:
GACAAGTTCGTCTTCGCTACTAGACGATAAAGACAGCATTCAAGGAAGTCGTAAGGCAGCACGACTCCCCATCTTCCCATAGTAAAGATGGAGGCGCCCTGCATGTAAACGACAGGTAAAACTACTTCCGCCTTTCTCCTGCGCCCTCGTCCAAGATGGCGGACGAGGCCACCCGGCGTGTCGTGTCTGAGATCCCGGTGCTGAAGACTAACGCCGGACCTCGAGATCGGGAGTTGTGGGTGCAGCGACTCAAGGAGGAATACCAGGCTCTTATCCGGTATGTGGAGAACAACAAGAATGCGGACAATGATTGGTTCCGACTGGAGTCCAACAAGGAAGGGACTCGGTGGTTTGGAAAATGCTGGTACATCCACGATCTCCTCAAATATGAGTTCGACATCGAGTTTGACATTCCTATCACATATCCTACTACTGCTCCAGAAATTGCAGTCCCTGAGCTGGATGGAAAAACAGCAAAGATGTACAGGGGTGGCAAAATATGTCTGACCGATCATTTTAAGCCTTTGTGGGCCAGGAACGTGCCCAAGTTTGGATTAGCTCATCTTATGGCTCTGGGGCTGGGTCCATGGCTGGCAGTGGAAATCCCCGATCTAATTCAGAAAGGCGTGATTCAGCATAAAGAGAAATGCAGCCAATGAAGGATCAAGCCGCTGAGGCTGAGACTTGGATAGGCTACGTTCCTGTTTTCCTGTGCATCCCTCTTCTTACTCATCCGACCGCTTCACTCACACCCCTTCGCCTACAGCGGTTACTAAGTAGCTGCAGCGGTACAGTTTCCAGCATTGCCGGGGTGAAAAAACAGTGTTGCTACTGAGTTTCTAAGTTAGGCTGTACAGGGAGGGGAGAGGCTGGGGCTTTGGAAAAACCGAAAGGTAATTTATACCCCTTCCCCAGGCGGAGCGGTGTGAGATCCTGGAAGGACAGGGGATGGTTGAAAGTGGGTACACAGTCTTTTTGGTTTCCGGAAATAACTCATCAATAAAAGCTGCTTCTTCTGGTG