Transcript asmbl_12210

Sequence
Transcript Sequence for observation asmbl_12210 of TGE0003671:
TAGCGGACTGCAGCCTGGAGGCTGACCATGTCGTCAGTGCTATTCCAGCTTCAGCGCTCGGCGCGCTGCTGCCTGCCGAGGCCTCACCACTGGCCGAAGTCCTGAGAACCATCCGAGCGGTGTCTGTGGCTGTGGTGAATCTGCAGTACCGCGGAGCTCGTCTGCCTGTCCAGGTGACACCGCGGAAGGGGAGACGCGGGCTCAAGTTCACGCCTCCCGGCTGAACCCATCCCTTCCTTTTGTCCAGGGGTTTGGACACTTGGTGCCGTCCTCGGAAGACCCAGGCGTCCTGGGGATCGTCTACGACTCAGTTGCTTTCCCTGAGCAGGATGGCAGCGCCCCCAGCCTCAGAGTGACTGTGATGCTGGGAGGTTCCTGGTTACAGACGCTCGAACCCGGAGGCTCCGGCCTATCCCGGGACCTGCTCCAACGCCAGGCACAGGAAGCAGCTGCCACACAATTAGGACTGAAGGGGCCACCAAGTCATTGCTTGGTTCATCTACACAGGAACTGCATCCCCCAGTATACACTAGGCCACTGGAAAAAACTGGAGTCAGCCACCCAGTTCCTGGCTGCTCACAGACTGCCCCTGACTCTGGCCGGAGCTTCCTATTGGGGGGTCGCTGTCAATGACTGTATAGAGAGTGGACGCCAGGCAGCAGCCCAGGTCCTGGGCTCAGCACCCCATAGCTGATCCCCACTCCCAGCACCTGCCTGCTGGCGGGGAGTCTCTCACCCATGACAATAAAAGTTGCTGGAGGTTG