Transcript asmbl_12189

Sequence
Transcript Sequence for observation asmbl_12189 of TGE0003665:
AGCTGCAGAAACGGCGCGGCTGTTCCCACAAAGCGTGGCTAGCGGAGCGCCATGAGCAGAGCACCCAGCGATCTCAAGCTCAGGCTGGCCCGGGCTGGGCAGGAGCACCTGCTGCGGTTCTGGGATGAGCTGGAAGAGGCCCAGCGGGCGGAGCTCTGTGCGGAGCTCCAGGCCATGGACTTCGAGGAGCTGAGCATCTTTTTCCAGAAGGCCACCGAAGGAGTCCACCAGTTCTCTCAGCTGGAGAAGGTGGATGCGCGGATGGAGCCTATCCCTCGGGAAGTGCTGGGCAGCGCTACGCGGGATCAAGATCAGCTCCAGGCCTGGGAAAGTGAAGGACTTTTCCAGATTTCTCAGAACAAAGTGGCTGTTCTTCTTCTAGCTGGCGGACAAGGGACAAGACTTGGTGTCTCGTATCCCAAGGGGATGTACGATGTTGGGTTGCCATCTCATAAGACACTTTTTCAGATTCAAGCAGAGCGGATCCTGAAGCTTCAGCAGTTAGCTGAAAAATACCATGGCAACAAGTGCACCATCCCGTGGTATATAATGACGAGCGGCAGAACAGTGGAGTCCACAGAGGAATCCTTCACCAGACACAAGTACTTCGGTTTGAAAAAGGAGAATGTGATCTTTTTTCAGCAGGGAATGCTACCAGCCATGAGTTTTGATGGGAAAATTATTTTGGAAGAGAAGAATAAGGTTTCTATGGCTCCAGATGGAAACGGTGGTCTTTACCGGGCTCTTGCGGCCCAGAACCTCGTGGAGGATATGGAGCAGAGAGGCGTCGAGAGTGTTCACGTGTACTGCGTCGACAACATTCTGGTCAGAGTGGCGGACCCCCGGTTCATCGGATTCTGCATTCACAAGGGAGCAGACTGTGGGGCGAAGGTGGTGGAGAAGACGAACCCCACGGAGCCGGTGGGCGTGGTGTGCCGGGTGGACGGCGTGTACCGCGTGGTGGAGTACAGCGAGATCTCCCTGGCCACCGCGCAGCGGCGGGGCCCCGACGGGCGGCTGCTGTTCAGCGCGGGCAACATCGCCAACCACTTCTTCACCGTGCGGTTCCTGAGAGACGTGGTCAGTGTTTATGAACCTCAGTTGCAGCACCATGTGGCTCAAAAGAAGATTCCATTTGTGGATCCCCAGGGGCAGTTAATTAAGCCAGACAAACCAAATGGAATAAAGATGGAAAAGTTCGTCTTCGACATCTTCCAGTTTGCAAAGAAGTTCGTGGTGTATGAGGTGTTACGGGAAGACGAGTTCTCCCCACTCAAGAACGCGGACAGTCACAGTGGCAAGGACAACCCCACCACGGCCAGGCACGCTCTGCTGTCCCTTCACCACCGCTGGGTGCTCAACGCGGGGGGCCACTTCGTAGACGGAAATGGCTCCCGCCTGCCCGCGATTCCCTGCTTGAAGGATGCCCACGACGTCCCTATCCAGTGCGAGATCTCCCCTCTCGTCTCCTACGCCGGAGAGGGACTAGAAAGTTACGTGGCCGGCAAAGAATTCCACGCGCCTTTAATCATTGGCGAGAATGGCGTCTGTGAGCTGGTGAAGGACGGCGTATGAGCCAGGTGCCAAGTTCCCCGCAGCGAGAGCAGCGCTTACGTGTGACAGACCAACTGTGAGCCTCCAGGCCCCTCCTGAGGCTACTCAAGTTCGAATGTCCACGAGTCTCCTTCTGCCTGTCGAACTCTCCTAACTACTACGTAGCCCCTGAGAAGCAGCGGCCTGAACTGCAGAGAGCACCGTTAAGGTTCTCAACTCACTGACGGTCTTATTTATAGTTTTCAGTTGTATAAAATTTTCCCCAGGCCAAGGACAGCAGTGCCACCCACGCAGTTCCCTGCAGCGTGAGGGTGGCCAGGCGTGCGCCCGCCCTTCGCCTGGGGCTAGAAGCTTGTCTTCAGAGTTCTTCGGGGTGACAGTACGCCCTTGTACATGTCAGAAGGTTTCTGCGATACTACAAGTTTGTTTTATTTTATCAAAAGTAAGCTTTTTCAAGAAAATAATTGGACAGTAAAATAAACTTTTCTTTTTGTCTCTGGA