Transcript asmbl_53235

Sequence
Transcript Sequence for observation asmbl_53235 of TGE0002767:
TGGGCGCGGGGGGAGGCGCGTCGCGAGGCGAGCGTCCTCCTTTTGTGCGAGCGCCGGCGGCTCGGCTTCTCGAAGGAGAAGAAACTGAGGCCTGGAATTTGATTAACTCATTCAAGGTTACCCAGTTGGTAATTCATTTGCACACCTGTTAGCAAGAAACAGAAGTTGAAGGACTGGAACAAGTGAACTAGGAAAGAGGGAACGCCAATCCAAGGATAGAAGGACAAGGACAGAATCACCAGCACTGGCTGAAGGTACCTTAACATGGGGAATCTTCTTAAAGTTTTGACATGCACAGACCTTGAGCAGGGGCCAAATTTTTTCCTTGATTTTGAAAATGCCCAGCCTACAGAGTCTGAGAAGGAAATTTATAATCAGGTGAATGTAGTATTAAAAGATGCAGAAGGCATCTTGGAGGACTTGCAGTCATACAGAGGAGCTGGCCACGAAATACGAGAGGCAATCCAGCATCCAGCAGATGAGAAGTTGCAAGAGAAGGCATGGGGTGCAGTTGTTCCACTAGTAGGCAAATTAAAGAAATTTTACGAATTTTCTCAGAGGTTAGAAGCAGCATTAAGAGGTCTTCTGGGAGCCTTAACAAGTACCCCATATTCTCCCACCCAGCATCTAGAGCGAGAGCAGGCTCTTGCTAAACAGTTTGCAGAAATTCTTCATTTCACACTCCGGTTTGATGAACTCAAGATGACAAATCCTGCCATACAGAATGATTTCAGCTATTATAGAAGAACATTGAGTCGTATGAGGATTAACAATGTACCGGCAGAAGGAGAAAATGAAGTAAATAATGAATTGGCAAATCGAATGTCTTTGTTTTATGCTGAGGCAACTCCAATGCTGAAAACCTTGAGTGATGCCACAACAAAATTTGTATCAGAGAATAAAAATTTACCAATAGAAAATACCACAGATTGTTTAAGCACAATGGCTAGTGTATGCAGAGTCATGCTGGAAACACCGGAATACAGAAGCAGATTTACAAATGAAGAGACAGTGTCATTCTGCTTGAGGGTAATGGTGGGTGTCATAATACTCTATGACCACGTACATCCAGTGGGAGCATTTGCTAAAACTTCCAAAATTGATATGAAAGGTTGTATCAAAGTTCTTAAGGACCAACCTCCTAATAGTGTGGAAGGTCTTCTAAATGCTCTCAGGTACACAACAAAACATTTGAATGATGAGACTACCTCCAAGCAAATTAAATCCATGCTGCAATAACAATTCTGGAATAAGCACCTGCTGTAGACAGAAGACAGTATTCTGCAATGACTGAGAATGCAGTTTTTTAGTGATTGCAATTACTATCTCATTTATTCTTGCTTTTATTTCTTTCCTCTGTTCCTCTTCCCTCTTTTTTAATCATGTTCTTAAGACTTCTTTTCTGTGCCAAAATCAGTAAAGTTACACTCTGAAGGGATATCATCCTTTCAAACGGGCCATCTAAGGCAGCTAATTATGCATTGCATTGGGGTCTCTACTGAGAAAAATTCTGTGACTTGAACTAAATATTTTTAAATGTGGATTTTTTTTGAAACTAATATTTAATATTGCTTCTCCTGCATGGCAAAACTGCCTATTCTGCTATTTAAAAACCCTCAATGACTTTATTTTCTACTGCCGCCTTTTTCATGTGCAACCAAAATGAAAATGTTTAAATTAACTGTGTTGTACAAATGGTACCCAACACAAACTTTTTTTAAATTAGTAATACTTTTGTTTAAAGTTTTAAGTTTGCATTTTGACTTTTTTTGTAAGGATGTATGTTGTGTGTTTAACCTTTATTAACTAACGTTAAAAGCTGTGATGTGTGCGTAGAATATTACGTATGCATGTTCATGTCTAAAGAATGGCTGTTGATGATAAAATAAAAATCAGCTTTCATTTTTCTAAGTGTGGCTTGGTTTACTGATGTTTTGTTTTTAGGCTTCTGAAGTTTTCCCCATGTATGTTTTTATGGAATGCATATATACATTACATGATTTTTTCTTCTTTTAGGGGAGAGCCGGG