Transcript asmbl_12131

Sequence
Transcript Sequence for observation asmbl_12131 of TGE0020735:
CCCTGCTCGGGAAGAAGCGAAAGTGCTTTGGCGGTTTGTCCATCTGCAGCTGCGGCTCCCCCAGCCCGGTGGTCCTGCGGCCACCGCTGGCCCCAGCCTCCTCTCGCCCTTCCTTGGATCAGAGCTCGGCCGAAGCCCTCGAAGTGCGCACACACACTCAGCTTGACACCCTGGCCGACTGGTTTTAAGGGGTGTGGCAGGAGGTTTTGGACTCGATGAGTTTCCACCGAAATGTCGGAGAAGTCAGGCCAGAGCACAAAAGCAAAGGATGGGAAAAAGTATGCGACACTCAGTTTATTTAATACTTACAAGGGGAAGTCATTAGAAACTCAGAAAACCACAGTTGCAGCTCGACATGGATTACAGAGTCTTGGAAAAGTTGGAATTTCACGGCGGATGCCTCCCCCTGCTAACCTTCCAAGTCTCAAAGCAGAAAACAAAGGCAATGACCCTAATGTGAACATCGTACCGAAAGACGGCACAGGGTGGGCGTCAAAGCCAGAGCAGCATGAGGAAGAAAAAACACCAGAAGTTCCACCAGCACAGCCAAAACCTGGGGTTGCAGCTCCCCCAGAAGTAGCACCTGCTCCCAAATCATGGGCCAGTAACAAGCAAGGAATCCAGGTGAACAGTCATTTTCAGCAAGAATTTCCGAGCTTGCAGGCAGCTGGGGATCAGGAAAAAAAAGAAAAAGAAGCAACCGATGACAACTATGGACCTGGACCTAGTTTACGCCCACCAAATGTTGCTTGTTGGAGAGATGGCGGTAAGTCTGCTGGCCCACCCTTAACCTCTGACCAAGATGAAAAGCTCCCTGGCCAGGATGAAAGCACAGCTGGATCATCAGAGCAAAATGACATCCTCAAGGTGGTGGAAAAGAGGATAGCTTGTGGTCCTCCGCAAGCTAAACTCAATGGACAGCAGCCTGCCCTCACTTCCCAGTACAGAGCCATGATGCCTCCCTATATGTTTCAGCAGTATCCAAGGATGGCGTATCCTCCTCTTCATGGTCCCATGAGGTTTCCACCTTCTTTATCTGAAGCAAACAAAGGTCTTCGAGGAAGAGGCCCGCCTCCTTCGTGGGCCTCTGAGCCTGAACGCCCCTCCATCCTTAGTGCATCAGAGCTGAAGGAGCTCGATAAATTTGATAACCTAGATGCTGAAGCTGATGAAGGTTGGGCAGGTGCCCAGATGGAAGTAGATTATACAGAACAGCTGAATTTCAGCGATGATGATGAGCAAGGAAGTAGTAGTCCTAAAGAAAACAGCAGTGAGGACCAAGGTTCAAAAGCCTCTGAAAACAGTGAAACCCGAAAAGAAGCAGATGAAGTGTGCAATACTAAATCGTCATCTCAGATACCTGCCCAGCCACCAGTAGCAAAAGGTCCCTATGGGAAAGGACCACCATTTAATCAGGAACGTGGACCATCTTCCCACCTGCCACCACCTCCAAAGCTGCTTGCACAGCAGCATCCTCCTCCAGACCGACAGGCAGTACCTGGAAGACCAGGCCCTTTCCCCGCCAAGCAGCAAGTACCTGACGAAGATGAAATATGGAAGCAGAGAAGAAGACAGCAGTCAGAACTTTCTGCAGCGGTGGAACGTGCTCGTAAACGGCGTGAAGAGGAAGAGCGAAGGATGGAAGAACAGAGGAAGGCAGCTTGTGCTGAGAAATTGAAACAGTTGGATGAAAAGCTTGGTATCGTGGACAAGCAGCCATCTCCGGAGGAAATCAGAGAAAGGGAGCGGGAAAAGGAACGGGAGCGGGAGAAAGAACTCGAAAAAGAACAAGAACGGGAGCGAGAGAAGGAGAGGGAAAAAGAAAGGGAGAGGCTGCAGGAGAAGGAGAAAGAGCTGGAGAGAGAGCAGGAGAAACA