Transcript asmbl_11000

Sequence
Transcript Sequence for observation asmbl_11000 of TGE0003598:
CGGTGTTGGGTAGTTCCGGTAGGGCGGGGCGCGGCCGAGGTCCCCAGACCAGAACTGGAGAGGATATTCGGGATCCCTACTCCGCTAGTGGAGAAAGGACCTGCCTCCCACGCACCCTCACCTAACCAGAGCGGGGATTTCTATGGCCCCTCCTGCTGGCTTTTTGAAGAAAGCGAAAGTGAAAGAGGGAAGAAGACTGAGGAGATCGCGGCGCCATGAAGCACCTGTCCCTGCTCCTCGCTCTGGCTTTGGGCTTGGTGACCGCCGTCTCGGCGGGACCCACGGTGATAGAATGCTGGTTCGTGGAGGATGCAGACGGGGGCCGCCTGGCCAAGAAACCCGCTGCATTGCTGCTGCGCCAGGGCCCAGGGAGAATACCTCCCCGGCCGGACCTCGACCCCAAGCGCTACCTCAGAGTACATGACCCCACAGGCACCCTGCAGGCTGCCTTCAGGCGGTACCCCCGGAGCGCCCCCACGCCACACTGCGAGATGAGCCATTACATCCCACTCCCCGCCTCTGTGAATTGGGTCAAAGGCCTGACTCCGGAGCAGAGCTGCCCGCGGGCCTTGGACGGGACTTGGTTCATGGTCAGCATGTCCAGCCCGGTCCTCAGCCTCTCCAGCCTCCTACAATCACAGACCGAGCCTCAGCCAGATCCTGGACTCATCACCATGGCAACAGCTGTGCTGACTGTCATCACCCACAACCCCACCACTAGAATCCAGCTGGGACAAGATGCTCTGCTGGACTTGAGCTTTGCTTACATGCCCTCCACCCCAGAGGCCACTACACCTCTGGCCCCAGGTCCCCCTCCCTTTGGGCTGGAGTGGCGACACCAGCACCTAGGGGAGGGGCACCTGCTCCTGGCTGCAACTCCTGGGCTGCGTGGGCAAATGCCAGCTGCCCGAGATGGGGCAGTGGCATTTGCCGCTTGGGATGATGATGAGTCATGGGGTCCATGGACTGGAAATGGGACCCTCTGGCTGCCTGCAGTGAAGCCTTCCCAGGAGGGTGCCTATCAGGCCACCATATACCTGCCATATCTGCAAGGACAGGTCACCCTGGAGCTTGCTGTGCAGAAATCCCCCAAAGTGTCCCTGATGCCATCACCTCTTGTATGGGCTGCCCCTGGGGAGGCACCCCCTGAGCTAGTTTGCCTTGTGTCCCACTTCTACCCCTCTGAGGGCCTGGAGGTGGAGTGGGAGCTCCGAGGTGGTCCAGAGGGGAGCTTTCAGAAGGCCAAGGGGCAGAGTTGGCTCTCAGCCCTGCACCACCACTTGGATGGCTCTGTCAGCCTCTCTGGGCACCTGCAGCCATCCCCGGTCACCACTGCACAGCACGGGGCGCGCTATGCCTGTCGTGTCCACCACCCCAGCCTACCCGCATTGGGGCGCAGTGCTGAAGTCACCCTGGAGGTGGCAGGTCTCTCTGGCCCCTCCCTGGAGGATGGTATAGGCCTCTTCCTGTCTGCTTTTCTGCTCTTGGGGCTCTTCAAGGTACTGGGCTGGGCAGCTGCCTACCTGTCCACTTCCAAGGAATCAAAGAAGAAAGCACAGTGAGGGCACTCAAGACCACCCTGGGGAAGCTACCATCATCTCTGACCTGAACTACTGTAGTAGCTCCTCCAAACAGTATGCCATCACCTGCTCCTGCTCCTGCTCCTTCCAATCTCTCTCCACGGTGGGAATGCTTTTTTAAAAAAGACACAAATCTATAGCATTCACCTTCTTAGAGCTCTAAGGCTGTGGTTCTCAAAATTTTTGGTCTCAGGACATCATAAAAACGAAGGACTCTCGAGCTTTTGTTTATGTGGGTTATAAACTAACTATTTATCATACTAGAACTTAAAACTGAGAAAAGTTTAAAACAGAAGGATACACAGGCACACATTCCATTGGCTGTGAAGGAGATAATGTCAATACACATCATGTAGCTCTGGGAAATTTCACTGTACATTTTTTTAGAGAATGAAAGTGAAAAAGGCAAATAACATTTTAGTGTTATGAAAATAGTCTTAACTTCGTATGCGCAGTGAATTAGTCTCAGAGATCTCTGGGGCAGGGACCACACCAAGAGAACGGGTGCTCTAGAGGCCAAATCCATTCTTCTTGCCCTTGGCACATGAATTTACGGCGCTGGAGCCACTGCTTACCTCTTCAACCCAATCTGGTGCTCTCCAGCACTCTCAATACTCATCACACCTACAGCTCTTCCTTTCCTCCAATGGCCTCTCACCTTCCCTAGGTCCCAGAGTTCTGTTCTCTCTGCCTGGTCCACCCTCGCTCTCCCTGGGCTCCAGACCAGATCAGCCAAGTCATTCCCCTCAGACCGCCGCGTGTCCCTCTTGTGCGGTTCACCACGGTTGTACTTAAGTGATTGTGCGAGTTGTTAAAGCCCGTTTCCCGGACTCTCAGCTCCTCGCAGTTGCAAAAACAAGTCTGTATGTCCACTGCTTTATCTCCCGCATCGGCAGTGGGCCTGGCGCCCACTGGAGGGCGCTCGGTATAAGAAGTTATAGTCCTTTTTTTCATCCTAAGGATTCAAAAACAGGTATAGGGTCAAGTAACTACTGGACGAAGGAAGCGGCGACTTAAGGACCTCCGAGGGGCAGGACCGTGGGCCAGACCGACGCGGGGAGCGAGTCTACTCGGTGGGAATAAAGTTGTGTTCCAGTGCTTCCAACG