Transcript asmbl_10219

Sequence
Transcript Sequence for observation asmbl_10219 of TGE0003554:
CAGGGACCGCCTACACCTGCGACGGACCACGGAGCAGCACGTGCCGGAGGTGGGCGTCCAGGTGAAGCGGAGGAGGACGGCGTCGCTGAGCAGCCACGAGTGTCCGCTGTACCCGAGGCGGTCCCAGCAGCAGGAGCCCGTGGTGGACTTCCAGGCGGAGCTGAGGCAGGCCTTCCTGGCCGAGACCCCGAGGGGTGGCTGAGGCCATCCTGGACGTCCAGGTAGCCGCTTCCGAGTGCAAAACAGGCCCCGTGCTCTGCCGCCGCTGCCCGCTGCCCGGCTGGCGTTGTCTGTGGCAGGACCTGTGCCGTCCCTGGTCTGTAGCCCTCCCTCAGGTCGGCGGTCCCGAGCTTCACCGCGAACGTCGGATCCGGTGGGCCTGCAATCATGACGGTGGGCAAGAGCAGCAAGATGCTGCAGCACATCGACTACCGCATGCGCTGCATCCTGCAGGACGGCCGCATCTTCATCGGCACCTTCAAGGCCTTCGACAAGCACATGAACTTGATCCTCTGCGACTGCGACGAGTTCCGGAAGATCAAGCCAAAGAACGCGAAGCAGCCGGAGCGTGAAGAGAAGCGGGTTTTGGGTCTGGTGCTGCTCCGAGGGGAGAACCTGGTCTCCATGACGGTGGAGGGGCCGCCCCCCAAAGACACCGGCATCGCTCGTGTGCCCCTCGCCGGAGCTGCAGGAGGCCCTGGAGTTGGCAGGGCCGCGGGCCGAGGAGTGCCAGCCGGCGTCCCCATTCCCCAGGCTCCTGCTGGATTAGCAGGCCCTGTCCGAGGGGTTGGGGGACCGTCCCAGCAGGTGATGACCCCACAGGGACGAGGCACTGTGGCAGCTGCGGCCGTCGCCGCTACCGCCAGCATTGCCGGAGCCCCAACGCAGTACCCACCAGGTCGGGGGACGCCCCCCACCCCTGTGGGCCGAGCCACCCCACCGCCAGGCATCATGGCTCCTCCCCCTGGCATGAGGCCACCTATGGGCCCACCAATCGGCCTTCCCCCGGCCCGTGGGACACCGATAGGCATGCCCCCCCCAGGCATGAGACCCCCGCCACCAGGAATCAGAGGCCCGCCTCCCCCGGGAATGCGCCCCCCGAGGCCCTAGGACGCTGTCGGTCCTCGGTCACCCCCGCAGTGCGTCTCGTGAAACCGTGTAGAGTGTTCGTGAGCCTTTGTTTCCTCTGCCGCCTCCGTGTTCGCCAATAAACGCATAAGCATGTCCACTG