Transcript asmbl_10107

Sequence
Transcript Sequence for observation asmbl_10107 of TGE0003544:
CTCCCGCCCGCTCCCTGCAGACCGCAGGCGCGTCGCCGCGCGCCCCTCCCACTCGCGCTCCTCCTCCCACGCCTCTTTGGCGCGCCGGCCCAGGACCCCTTTGATCCAGTCCCAGGCGCGTTCCCCCACCACTGTGCGACCCCGCCTTTTTCAACACCCTGGGGTGAGCCGAGCTTGGGCCAATATCAGGAAAGCCCCTGAAAGTCCCAGCCCAGCCAAGAAGTAACAGGACCCTGCCCAGTCCCGGGAGCAGAGCGGCCAGGAGGAGGAAGGCTCCAAGGCGCCCCCGCCCTCGGGTCCGCTACTTGCCGGGTCCCTATTGGCTGGCGCGCTCGGCGACTGAAACAGCCGTGGGAGGGGAATTCTCGTTTATAAAAACTGCGCCCTTGGCAGGGTCCCGTCCTCTGCAACTCTTGCTCCGGGGTCCCCGCGCCAGAGACGCAGCAGCGCTCCCACCGCCCACACCCACCGCGCCCTCGCTCGCCTCTCCGCCGAAAGCCAGTCCGCGCCGCCGCAGCTGCCCAGCCCGCCACCACCCTCCGCAGTCATGTCCACCAGGTCCGTATCCTCGTCCTCCTACCGTAGGATGTTCGGCGGCCCAGGCACCGCCAGCCGGCCGAGCTCCAGCCGGAGCTATGTGACCTCGTCCACCCGCACTTACAGCCTGGACGGCGCGCTGCGCCCCAGCACGGGCCGCAGCTTGTACGCCTCGTCGCCCGGCGGCGTGTATGCCAAGCGCTCCTCGGCTGTGCGCCTGTGGAGCGGTGCCCCCCGCGTGCGGACGCTGCAGGACTCGGTAGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCCGTACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACAAGGTGCGCTTCCTGGAGCAGCAGAACAAGATCCTGCTGGCCGAGCTCGAGCAACTCAAGGGCCAGGGCAAGTCGCGCCTGGGGGACCTTTACGAGGAGGAGATGCGGGAGCTGCGCCGGCAGGTGGACCAGCTCACCAACGACAAGGCCCGCGTGGAGGTGGAGCGCGACAATCTGGCCGAGGACATCATGAGGCTCCGGGAGAAGTTGCAGGAGGAGATGCTTCAGAGAGAGGAAGCCGAGAGCACCCTGCAGTCCTTCAGACAGGATGTTGATGGTGCTTCTTTGGCACGTCTTAACCTTGAGCGTAAAGTGGAATCCTTGCAGGAAGAGATTGCCTTTTTGAAGAAACTCCATGACGAGGAAATCCAGGAGCTGCAGGCCCAGATTCAGGAACAGCATGTCCAGATCGATGTGGATGTTTCTAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAGTATGAAAATGTGGCTGCCAAGAACCTTCAGGAGGCTGAGGAATGGTACAAGTCCAAGTTTGCTGACCTCTCCGAGGCTGCTAACCGGAATAATGATGCCCTGCGCCAGGCGAAACAGGAGTCAAATGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGACGCGCTGAAAGGATCTAATGAGTCTCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCTATGGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAACATGAAGGAAGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTGAATGTTAAGATGGCTCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGATTGCTCTGCCTCTTCCAACCTTTTCTTCCCTGAACCTGAGGGGTAAGTATTTGATTGCTCTTTAGGAAAAATTTTAGGAGCTTGTAACTATTCCGTTTCTAAAGCACACATTTTTAAATGATACTTGAAAAATGCCAAGGGAAAATTCGATAAAACATCTATAATTTTGAAACCTAAGTACTGTCTTACCTTCTCTGCAAACTCCCATTTAACTTCCTTCTGATGGAGTATATATACTGCAGGAGTCTGTCTCATAGTGATTGCTTCAGTGGCATCAGACCCTGAGTTTTAAAATAGGTGACATTCTTTAGAATTATTTTGAAAGTAGTGCTTTAAACAATCGTGAACAAAAATCAAAATTATGTGAGCAAAATAGTTATTTGTCTTTTCAAAATTTCATTTTTACACATTTGGGGCCTTCGTTTTCTTTATTCAGAAACCAATCTGGATTCGCTCCCTCTGGTTGACACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGG