Transcript asmbl_9903

Sequence
Transcript Sequence for observation asmbl_9903 of TGE0003539:
GAGCCCTGCGGTCTCGGGGGAGGAGGCAGCGCGCAGGGAGCAGCGGGAAGGCGCTCGGGAGCCGGAGCGGGCGCGGCGGCGGTGGGCCCGAAAACACTAGAATCTTCTGGTGCCATCAGAAATGTCTCCCTTAAGTGGCAAAGTCCAGACTGTCTTGGGGCTGGTGGAGCCGAACAAACTGGGCCGCACCCTGACCCACGAACATCTGACAATGACCTTTAACTGCTCTTACCACCCACCGCCTCCATCTCATGAAGCTCTCTCTCGGGAGCCTATTATGATGAAAAATTTGTTTTGGATTCAGAAAAACCCTTACTCCCATAAAGAGAATCTTCAGCTGAATCAGGAGACGGAAGCCATCAAGGAAGAACTGTTGTATTTTAAAGCCAAAGGTGGAGGGGCCTTGGTGGAGAACACGACCACTGGGATCAGCCGCGACGTGCAGACTTTGAAGCGGCTGGCGGAAGAGACGGGCATTCACATCATATCTGGAGCTGGGTTTTACGTGGATGCAACTCACTCTTCTGAGACCAGAGCCATGTCGGTGGAGCAGCTGACTGACGTCCTCGTTAATGAAATTCTCCATGGAGCTGATGGGACCAGTATCAAGTGTGGCGTTATTGGAGAAATCGGTTGCTCCTGGCCTCTGACTGACAGTGAAAGGAAGGTTCTCCAGGCGACGGCTCATGCCCAGGCCCAGCTCGGCTGTCCTGTTATCATTCACCCTGGAAGGAATGCAGCCGCACCCGTTCAGATCATCCGAGTACTGCAAGAAGCAGGTGCAGACATCTCCAAAACAGTTATGTCGCACATCGATAGGACTATACATGATAAGAAGGAACTACTGGAGTTTGCTCAACTTGGCTGTTACTTGGAATATGATCTCTTTGGTACCGAACTCCTTCATTACCAATTCAACCCAGATATTGACATGCCTGATGATAATAAAAGAATTAGAAGGGTGCGTCTTCTGGTGGATGAGGGCTATGAAGATCGAATTCTGATGGCACACGACATACACACGAAGCACCGGCTGATGAAATACGGAGGTCACGGCTATTCTCACATACTCACCAACGTTGTCCCTAAAATGTTGCTCAGAGGTATAACTGAGAATGCGCTTGATAAGATACTGATAGAGAACCCTAAGCAATGGCTGACTTTCAAATAGGATGGTTAGGAATTCACACCTTGAGCATAAAGCTTACAGAGATCATCCGGTGGTTTCGAACCCAGTGAGTTATCAATCAGACCTACATAGGGCTAATGACAGATCATTTGCATTTTATGGGAATTAGAAGAGTTTTCCCTTCTCAGAAACTGGCTATTACATCTGAACCTGCAAGGGGCCTCACTCAGCCCACTGCCTTAACAAAATAAATACACAAAATACCTATTTCCAAACCATGATTTACAGTCTATATCCTCTTGGTAGAGTTTTGTTTTGTTTTGTTTTCTTAATCTATCAGCTGTACTACTTGTGAAAATTTAAAGTGTTTCTAGTTAAATTACCCCCTTCTGGAGCAATCTAATGTTTCTTGTAGTATTGATGATCCTACTAATTATCCTGCTGTTCTTTAATTAATGCTTAATGAATAATATGGCACTTTAAAATAAAACAGCTTCTGCAGCAAGGGAAGTTAAATTCTGAGATTTCTTTT