Transcript asmbl_9859

Sequence
Transcript Sequence for observation asmbl_9859 of TGE0003531:
GCGGTAAACTGGAAAGATGTCCCTGTATGATGACCTGGGAGTGGAGACCAGCGACTCGAAGACGGAAGGCTGGTCCAAGAACTTCAAGCTGCTGCAGTCTCAGCTTCAGGTGAAGAAGGCGGCCCTCACCCAGGCGAAGAGCCAGAGGACAAAACAAAGCACAGTCCTCGCCCCGGTAATCGACCTAAAGCGAGGCGGCTCTTCAGACGACCGGCAGGTCGTGGACACCCCGCCGCACGTAGCCGCCGGCCTCAAGGATCCTGTACCCAGTGGATTTTCCGCGGGAGAAGTTCTGATTCCCTTAGCCGACGAATACGACCCTATGTTCCCTAACGATTATGAGAAAGTCGTGAAACGCCAGAGAGAGGAGCGACAGAGACAGCGAGAGCTGGAAAGACAGAAAGAAATAGAAGAGAGAGAAAAGAGGCGTAAAGACCGACACGAGGCCAGTGGGTTTTCAAGGCGACCAGACCCAGATTCTGATGAAGATGAAGATTACGAGCGAGAGAGGAGGAAAAGAAGTATGGGCGGAGCCGCCATCGCCCCACCCACCTCTCTCGTGGAGAAAGACAAAGAGTTACCCCGAGAATTTCCTTACGAAGAGGACTCCCGACCGCGCTCACAGTCTTCCAAAGCCGCCGTTCCTCCGCCGGTGTACGAGGAGCAGGACAGGCCCCGGTCCCCAACGGGGCCTGGCAACTCCTTCCTCGCCAACATGGGGGGCACGGTCGCTCATAAAATCATGCAGAAGTACGGCTTCCGGGAAGGCCAGGGGCTCGGGAAGCACGAGCAAGGGCTGAGCACGGCGTTGTCGGTGGAGAAGACGAGCAAGCGAGGAGGCAAGATCATTGTGGGCGAAGTCACAGAGAAAGATGCATCCAAGAAGTCGGATTCAAATCCACTAACTGAAATACTTAAGTGTCCTACTAAAGTGGTCCTACTAAGGAACATGGTTGGTGCAGGAGAGGTAGATGAAGACTTGGAGGTTGAAACCAAGGAAGAGTGTGAAAAATATGGCAAAGTTGGAAAATGTGTGATATTCGAAATCCCTGGTGCCCCTGACGATGAAGCAGTGCGGATATTTTTAGAATTCGAGAGGGTCGAATCAGCAATTAAAGCTGTCGTAGATCTGAATGGGAGGTATTTCGGTGGCCGGGTGGTAAAAGCATGTTTCTACAATTTGGATAAGTTCAGAGTCTTGGATTTGGCGGAACAAGTTTGATTTTAAGAACTGGAGCACGAACCACAAGCTCCAAGCCGAGCAGAGGAGGCGACAGCCAGCTCGCGTGCTGTGTGCGCAGGGACTCAGAAGGGCTGCTGAGATGTGTGTTGATTGGTCCCTTTTTTTTTATTTTGTGTTTTTTTAATATAGCATAAAAATCCTTAAAAA