Transcript asmbl_9600

Sequence
Transcript Sequence for observation asmbl_9600 of TGE0003530:
AGCATCCATTGAATTTATTCGACGTAACCACAGAGGTACCGTCTTCATACCGCCACACAGACACAAACACAGCCACAGCACAATGTCCATATCGGCGCAGGCGCACTCCTTCTGCGGCTCATTTATACGTCTTCATGTGCCACAGTCCGTCGTTTAGATAATGGATATTTTCGATGCCGATCCCCTTGTTGACTTTCTCGATGTCTTCCGCAGACATCTTCATGACTCCGACACACAGGGCGTGCTGTTTTCCTTCCGCCATGATGGCCACCACCGTATCCACCGCGGCAGGGTACAGCTTGGCCCCGGGAGACGTCAGGCCTGGACACATGATGTTCGCGCCACTGAGGACAAATTTGATGGCTCCTTTATCCACCTGCTGGCGCGGCAGGATAAACGGGTACTTGTGGAGCAGCCTCAGCGTCGGGTAAAAAGGCCCTTCTCTTTGTCTAAAAAACAGCAGCTCCCCGTTGACCGTGAGGATCTCTATGTGCTCGTGGCACCGCACTATTTTGACGGGGTCTTTCTTGGGCATGATTTGGTTAAGCCACGGTTCGATGCCTGGAAACTGCTCTGTCAACTGGTTCTTAATGCCCTTAATAACGGACGTTTTCAGCTGGATGCAGTTGGACACGTTTTCCTTCTCGTCGAATTTCTTGAACATGATCCAAGGTGAAGGGGGCGACAGTACGGAAACGCCCGCAACCAGGGAAAAGCTGATCCCGCGAGGCTCGGGCAGGAGCGCTTACCCGCGGAGCGCCGGCGAGACGGTCGCGGCGGC