Transcript asmbl_9548

Sequence
Transcript Sequence for observation asmbl_9548 of TGE0003521:
GGTGGATCTGTAGAGAGACCAGCTGACTAGGAGAGGGAGGGGAGGAGCCCAGCTGTGAGGTGTGTGAGCCTAAGAACCATGTCTACGCGGGAGTCCTTTAACCCAGAAAGTTATGAATTGGACAAGAGCTTCCGGCTAACCAGATTCACTGAACTGAAGGGCACTGGCTGCAAAGTGCCCCAAGATGTCCTGCAGAAATTGCTGGAATCCTTACAAGAGAACCACTTCCAAGAAGATGAACAGTTTCTGGGAGCAGTTATGCCAAGGCTTGGCATTGGGATGGATACTTGTGTCATTCCTTTGAGGCATGGTGGTCTTTCCTTGGTTCAAACCACAGATTACATTTATCCTATCGTCGATGACCCTTACATGATGGGCAGGATAGCATGTGCCAATGTTCTCAGTGACCTCTATGCAATGGGGGTCACAGAATGTGACAATATGCTGATGCTCCTTGGAATCAGTAATAAAATGACCGACAGGGAAAGGGATAAAGTGATGCCCCTAATTATACAGGGTTTTAAAGATGCAGCAGAGGAGGCAGGAACGTCTGTAACGGGCGGCCAAACAGTGTTAAACCCCTGGATTGTTTTGGGAGGAGTGGCTACAACTGTCTGCCAGCCCAATGAATTCATCATGCCAGATAACGCAGTGCCTGGGGACGTGCTAGTGCTGACGAAGCCCCTGGGGACGCAAGTGGCCGTGGCCGTGCACCAATGGCTGGATATTCCTGAAAAATGGAATAAAATTAAATTAGTGGTGACCCAAGAAGACGTGGAGTTGGCATACCAGGAGGCCATGATGAACATGGCAAGGCTCAACAGGACAGCTGCGGGACTCATGCACACGTTCAACGCCCACGCCGCCACCGACATCACGGGCTTCGGGATTCTGGGCCACGCGCAGAACCTGGCCAAACAGCAGAGGAACGAGGTTTCCTTCGTGATTCACAACCTCCCCGTCCTGGCCAAGATGGCTGCTGTGAGCAAGGCCTGTGGGAACATGTTTGGCCTCATGCATGGGACCTGCCCCGAGACATCAGGTACAAGGATCCTGGGCCCAAATCCGAGGATTAACTAGTGAGGCTAATGGAAAGTGCCATGAGAAGGAAGAAGCCAAGAGGCCTTCTAATCTGTTTACCACGTGAGCAAGCTGCTCGGTTCTGTGCAGAGATAAAGTCCCCCAAATATGGTGAAGGTCACCAAGCATGGATTATTGGGATCGTAGAGAAGGGCAACCGTACCGCCAGAATCATAGACAAACCCCGGATCATTGAAGTCGCACCACAGGTGGCCACTCAAAATGTGAATCCCACACCTGGTGCCACCTCTTAATCCAGACCGAAATAGCTATTTGGTTTTGTTTTTAAATAGATCTATTTCCTTTATCATCATTTCAATTAAAGACTATAAACAACAACAAAAATCTCATTGTGTCTACACATCTGGTGACCTGAGGTCGATTTGTGAAATGGATGCAATTAATAAAATAAAATCCATTGCCTTTTTTTCCTGTTACATTAACTGAAGATGCACCTAATCTTGAGGCAGCTTCTGAGTTGAGACTTATATTGTTATCC