Transcript asmbl_9502

Sequence
Transcript Sequence for observation asmbl_9502 of TGE0003509:
GCGCGACCCGGGGAACCGGCATTGGATTGGCGTCTCTCCCTCATTATGCTGGGCTGGGGAGAAAGGCGAATGGCCTAGTGGTCAGCAGCATGGATTGCAAGCCAGACCACCTGGGTTCAGATCTTAGCTCTGACAGCTCTGTGACCTTGGATGTCCAGCTCGCCGCTGTCCAAGAAACGTCGCGTGTCCGGGCCTGATCCAAAGCCGGGTTCTAACTGTTCCCCCGCCCAGTCTGTGTTGTCCGAAGTGCCCTCGGTGCCAACTAACGGAATGGCGAAGAACGGCAGTGAAGCAGACATAGATGAGGGCCTTTACTCTCGGCAGCTGTACGTGTTGGGCCATGAGGCAATGAAGCGGCTCCAGACATCCAGCGTACTGGTATCAGGCCTGCGGGGCCTGGGCGTGGAGATTGCCAAAAACATCATCCTTGGTGGGGTCAAGGCTGTCACCCTACATGACCAGGGCACTGCCCAGTGGGCTGACCTCTCTTCCCAGTTCTACCTGCGGGAGGAGGACATTGGTAAAAACCGGGCAGAGGTCTCCCAGCCCCGTCTTGCTGAACTCAACAGCTACGTGCCTGTCAGCGCCTACACTGGGCCTCTTGTCGAGGACTTCCTTAGTGGCTTCCAGGTGGTGGTCCTCACCAACACCCCCCTGGAGGACCAGCTTCGGGTGGGTGAGTTCTGTCACAGCCGTGGCATCAAGCTGGTGGTGGCAGACACACGGGGCCTATTTGGACAACTCTTCTGTGACTTCGGAGAAGAAATGATTCTCACTGATTCCAATGGAGAGCAGCCACTCAGTGCTATGGTTTCTATGGTCACCAAGGACAACCCCGGTGTGGTTACCTGCCTGGATGAGGCCCGACATGGGTTTGAGAATGGCGACTTTGTCTCCTTCTCAGAAGTACAGGGCATGGTTGAACTCAACGGAAGTCAGCCCATGGAGATCAAAGTTCTGGGTCCTTACACCTTTAGCATCTGTGACACCTCTCACTTCTCTGACTATATCCGTGGTGGTATCGTCAGTCAGGTCAAAGTACCTAAGAAGATCAGCTTTAAATCTTTGCTGGCCTCACTGGCAGAGCCCAACTTCGTGATGACAGACTTTGCCAAGTTTTCCCGTCCTGCACAGCTGCACATTGGCTTCCAGGCCCTGCACCAGTTCTGTGCTCAGCACGGCCGGGCCCCTCGGCCCCGCAATGAGGAGGATGCAACAGAGCTAGTGACCTTAGCCCAGGCCATGAATGCTCGAGCCCTGCCAGCAGTGCAGCAGGACAGTCTGGATGAGGACCTCATCCGGAAGCTGGCATATGTGGCTGCTGGGGATCTGGCACCCATAAACGCCTTCATTGGGGGCCTGGCTGCCCAGGAGGTCATGAAGGCCTGCTCTGGGAAGTTTATGCCTATCATGCAGTGGCTATACTTTGATGCTCTGGAGTGTCTCCCTGAGAACAAAGAGGCCCTCACAGAGGACAAGTGCCTCCCGCGCCAGAACCGTTACGATGGGCAGGTGGCTGTATTTGGCTCAGACCTACAAGAGAAGCTGGGCAAGCAGAAATACTTCCTGGTGGGTGCAGGAGCCATTGGCTGTGAGCTGCTCAAGAACTTTGCAATGATTGGATTGGGCTGTGGAGAAGGCGGAGAAATTGTCGTCACAGACATGGACACCATTGAGAAGTCAAATCTGAACCGACAGTTTCTCTTCCGGCCCTGGGATGTTACGAAGTTAAAGTCTGACACCGCTGCTGCAGCTGTGCACCAGATGAATCCACACATCCAGGTGACAAGCCACCAGAACCGTGTGGGCCCTGACACAGAGCGCATCTATGACGATGAGTTCTTCCAAAACTTGGACGGTGTGGCCAATGCCCTGGACAATGTGGATGCTCGCATGTACATGGACCGCCGCTGCGTGTACTACCGTAAGCCGCTGCTAGAGTCAGGCACACTGGGCACCAAGGGCAACGTGCAGGTGGTGATCCCCTTCCTGACAGAGTCGTACAGCTCTAGCCAGGACCCGCCTGAGAAGTCCATCCCTATCTGCACGCTGAAGAACTTCCCCAACGCTATCGAGCACACCCTGCAGTGGGCTCGGGATGAGTTTGAAGGCCTTTTCAAGCAGCCAGCAGAAAACGTCAACCAGTACCTCACAGACCCCAAGTTTGTGGAGCGGACCCTGCGGCTGGCGGGCACCCAACCTCTGGAGGTGCTGGAGGCCGTGCAGCGCAGCCTGGTGCTGCAGCGGCCACAGACCTGGGCTGACTGTGTGACCTGGGCTTGTCACCACTGGCACACTCAGTACTCTAACAACATCCGGCAGCTGCTGCACAACTTCCCTCCTGACCAGCTCACGAGCTCAGGAGCTCCGTTTTGGTCTGGGCCCAAACGCTGTCCGCATCCGCTCACCTTTGATGTCAGCAATCCCCTGCATCTGGACTACGTGATGGCTGCCGCTAACCTGTTTGCCCAAACCTACGGGCTGACGGGCTCTCAGGACCGAGCTGCGGTGGCCGCCCTCCTACAGGCTGTTCAGGTCCCCGAGTTCACCCCTAAGTCTGGCGTCAAGATCCACGTCTCTGACCAGGAGCTGCAGAGTGCCAATGCCTCTGTTGATGACAGCCGTCTAGAGGAGCTCAAGGCCACACTGCCTAGTCCAGAAAAGCTCCCTGGATTCAAGATGTACCCCATCGACTTTGAGAAGGATGATGACAGCAACTTCCATATGGATTTCATTGTGGCTGCATCCAACCTTCGGGCAGAGAACTATGACATTCCCCCTGCAGACCGGCACAAGAGCAAGCTGATTGCAGGGAAGATCATCCCAGCCATAGCCACAAGCACAGCAGCTGTGGTTGGCCTTGTGTGTCTGGAGCTCTACAAGGTGGTGCAGGGACACCGACGGCTTGACTCCTACAAGAATGGTTTCCTCAACTTAGCCCTACCCTTTTTCGGCTTCTCTGAACCCCTTGCCGCACCCCGTCACCAGTACTATAACCAAGAGTGGACGTTGTGGGATCGCTTTGAGGTACAGGGGCTGCAGCCTAACGGTGAGGAGATGACCCTCAAACAGTTCCTTGACTACTTTAAGACAGAGCATAAATTGGAGATCACCATGCTGTCCCAGGGTGTGTCCATGCTTTACTCCTTTTTCATGCCAGCTGCCAAGCTCAAGGAACGATTGGATCAGCCGATGACAGAGATCGTAAGCCGTGTGTCGAAGCGAAAGCTGGGCCGCCATGTGCGGGCGCTGGTGCTTGAGCTGTGCTGCAACGACGAGAGCGGCGAGGACGTCGAGGTCCCCTACGTACGATACACCATCCGCTGACCCCCAGCCCCTCCTGTAGACTGGCCCCAGGCCCCCTCTCCAAACCCCTTCCAGCCCAGGGCTCCCAGTTGACCTCTGGCAGTGGCCCAGCTAGCCAAGCCTGGTGTTCCCTCTTCATCCCCCTACTTGAACCCCTCTTGCCGCTGCTTCCTACCTTGTTCAGAACCTGAATCCTAATAAAGAGTTATTAACCCA