Transcript asmbl_8825

Sequence
Transcript Sequence for observation asmbl_8825 of TGE0007905:
AGCAACAGCAGCAGCAGCAGCAGCCTCGCCCTCCTCCTCGCCAGCAGGAAAGAGCCCACTTGGAGAGTCTGGGGCTCAGTAGGCCTAGTCCCCAGCTGTTGGCAGAAACCCCTGTGCCTGGCCTCCCTGAGTTCCCACGGGCAGCCTCCCAGCAGGAGATCGAGCAGTCCATCGAAACCCTCAACATGCTGATGCTGGACCTGGAGCCAGCTGCGGCTGCCGCCCCCCTGCACAAATCCCAGAGTGTCCCAGGGGCCTGGCCAGGGGCCTCCCCGCTCTCTTCCCAGCCCTTCTCCGGCTCCTCCTGCCAGTCCCATCCGCTGACCCAGTCCAGATCTGGCTACATCCCCAGTGGGCATTCCTTGGGAACCCCTGAGCCAGCTCCACAGGCCTCCCTGGAGTCCGTCCCTCCTGGCAGGCCTTACTCACCTTATGATTATCAGCCATGTCCGGCTGGGCCCAACCAGAGCTACCGTCCAAAGAGCCCAGCTTCCTCCTCCACGTCCTCTGCCTTCCTTCCAACCACTCACAGCCCTTCAGGGCCTCAGCAGCCTCCGGCATCTCTCCCTGGCCTCACCGCTCAGCCTCAGCTCTCACCAAAGGAAGCGACTTCAGATCCATCCCGAACTCCGGAGGAGGAACCCTTGAACTTGGAGGGGCTAGTGGCCCACCGGGTAGCAGGGGTGCAGGCTCGGGAGAAGCAGCCTGCAGAGCCCCCGGCCCCTCTCCGGAGGCGGGCGGCCAGTGATGGACAGTATGAGAACCAGTCTTCAGAACCCTCATCTCCCCGGAGCCCTGGGGTTCGCTCCCCTGTCCAGTGCGTCTCCCCAGAGCTGGCTCTCACCATCGCTCTTAATCCTGGAGGACGGCCCAAAGAGCCCCATCTGCACAGCTACAAGGAGGCTTTTGAGGAGATGGAGGGAACCTCTCCGACCAGCCCACCGCCCAGTGGGGTGCGCTCCCCTCCAGGTCTGGCCAAGACACCCCTGTCTGCTCTGGGCCTGAAACCCCACAACCCAGCGGACATCCTGTTGCACCCCACAGGTGAGCCTCGGAGCTACGTCGAGTCGGTGGTGCGGACGGCAGTAGCTGGGCCCCGAGCTCAGGACCCTGAGCCCAAGAGCTTTAGCGCCCCAGCTGCCCAGGCCTATGGCCATGAGACGCCCCTGAGGAATGGGACCCTGGGTGGCTCCTTTGTCTCCCCCAGCCCCCTCTCCACCAGCAGCCCCATCCTCAGCGCTGACAGCACTTCAGTGGGGAGTTTCCCGTCAGGAGAGAGCAGTGACCAGGGCCCCCGGACACCCACCCAGCCTTTGCTGGATTCCGGCTTCCGCTCCGGCAGCCTGAGCCAGCCCAGCCCTTCGGCTCAGAGAAGCTACCAGAGTTCTTCTCCTCTCCCGGCCGTGGGCAGCAGCTACAGCAGCCACGACTACTCACTGCAGCAGTTCAACTCCCCAGAAAGCCAGGCCCGGGCTCAGTTTGCTGTGCCCAGCGTCCACACGGTACCCGGGAGCCCTCAGGCACGCCAGAGGACAGTGGGCACCAATACTCCCCCTAGCCCTGGCTTTGGTCGCCGAGCCATCAACCCCAGCATGGCTGCCCCTGGCAGCCCCAGTTTGAGCCACCGCCAGGTGATGGGCCCATCAGGAGCTGGTTTCCATGGTAACACAGTTTCCAGCCCCCAGAGCAGTGCAGCGACCACTCCAGGAAGCCCCAGCCGGGGCCAGCACCCTGGGGCCCACCAGGCCTCAGGCCTCCATGGCAGTGTGGTCACCACTCCAGGGAGCCCAAGCCTGGGCCGGCACCCAGGAACCCACCAGGGCAACCTGGCCCCCAGTCTCCATGGCAACACAATAGCCAGCCCCGGAAGCCCCAGCCTGGGCCGGCACCTGGGAGGATCTGGATCTGTGGTTCCCGGAAGCCCCAGCTTAGACCGGCACGTGGCCTATGGCGGCTACTCCACCCCTGAGGACCGGAGACCCACGCTGTCCCGGCAGAGCAGTGCCTCCGGCTACCAGGCTCCCTCCACGCCCTCCTTCCCTGTGTCCTCTGCCTACTACCCTGGTCTGAGTAGCCCTGCCACCTCCCCCTCGCCGGATTCAGCAGCCTTCCGGCAAGGGAGCCCAACACCGGCCTTGCCAGAGAAGCGGAGGATGTCCATGGGAGACCGGGCGGGCAGCCTCCCCAACTATGCTACCATCAACGGGAAGGTGTCCTCCTCGCCTGTCGCCAGCGGCATGTCCAGTCCCAGTGGGAGCAGCACCGTCTCCTTCTCTCATACTCTGCCTGACTTCTCCAAGTACTCCATGCCAGACAACAGCCCTGAGACCCGGGCTAAAGTGAAATTTGTCCAGGACACTTCCAAGTATTGGTACAAGCCTGAGATCTCTAGAGAGCAGGCCATCGCACTCCTGAAGGACCAGGAACCAGGGGCCTTCATCATCCGTGACAGTCACTCCTTCCGAGGGGCCTATGGGCTGGCCATGAAGGTGTCATCTCCCCCTCCGACCATTATGCAGCAGAATAAAAAAGGGGACATGACCCATGAGCTGGTGAGACATTTCCTGATAGAGACTGGCCCTAGAGGAGTCAAGCTCAAGGGGTGCCCCAATGAGCCAAACTTTGGATCCCTCTCTGCCCTGGTCTACCAGCACTCCATCATCCCACTGGCTCTGCCCTGCAAGCTGGTCATTCCAAACCGAGATCCCACAGATGAATCGAAAGATAGCTCAGGCCCTGCCAACTCAACCACTGACCTGTTGAAGCAAGGGGCAGCCTGTAACGTGCTCTTCGTCAACTCTGTGGATATGGAGTCACTCACTGGGCCACAGGCCATCTCCAAAGCCACTTCTGAGACACTGGCTGCTGACCCCACGCCGGCTGCCACCATTGTTCACTTCAAAGTTTCTGCCCAGGGAATTACACTGACTGACAACCAGAGGAAGCTCTTCTTCAGACGACACTACCCCCTCAACACTGTCACTTTCTGTGACCTGGATCCACAGGAGAGAAAGTGGATGAAGACGGAGGGAGGGGCCCCTGCTAAGCTCTTCGGCTTTGTGGCCCGGAAGCAGGGCAGCACCACGGACAACGCCTGCCACCTCTTCGCTGAGCTTGACCCTAACCAGCCTGCTTCCGCCATTGTCAACTTTGTCTCCAAGGTCATGCTGAGTGCTGGCCAGAAGAGATGAACCCACCCCTTGCCTGGGGCCAGGGCAGTGGGGATGGGGCATGTGGGGGCGGGGAGACCCATGAATCCTGACCACCTTTAAATCCAGAAGGAGGACTTTGGGCTAATTTTGGAGAAGGAGAGAAGAAAGTGCAATGTGGGGAGAGGGAAGTGAATCGCAGAGGGGAGGGGGAGAGCGGGAGAGAAAGAAAGAAAAAGATGGAGGAGGATTACTGGGATTCCTTTGGTTAGATGGATACTACGTAACCCCAAAGCCTCCCAAACTAACCAGGTCCACCTAACTCTCCCTCACCCTCCCAGAAGACAGAGTTTCTCAAAGGAGGCAGAACGGACCTCCTTGGGGATCCATGTTTTGAGGGGAATGGAAAAGCTCTGTCTCC