Transcript asmbl_8823

Sequence
Transcript Sequence for observation asmbl_8823 of TGE0007905:
AGCAACAGCAGCAGCAGCAGCAGCCTCGCCCTCCTCCTCGCCAGCAGGAAAGAGCCCACTTGGAGAGTCTGGGGCTCAGTAGGCCTAGTCCCCAGCTGTTGGCAGAAACCCCTGTGCCTGGCCTCCCTGAGTTCCCACGGGCAGCCTCCCAGCAGGAGATCGAGCAGTCCATCGAAACCCTCAACATGCTGATGCTGGACCTGGAGCCAGCTGCGGCTGCCGCCCCCCTGCACAAATCCCAGAGTGTCCCAGGGGCCTGGCCAGGGGCCTCCCCGCTCTCTTCCCAGCCCTTCTCCGGCTCCTCCTGCCAGTCCCATCCGCTGACCCAGTCCAGATCTGGCTACATCCCCAGTGGGCATTCCTTGGGAACCCCTGAGCCAGCTCCACAGGCCTCCCTGGAGTCCGTCCCTCCTGGCAGGCCTTACTCACCTTATGATTATCAGCCATGTCCGGCTGGGCCCAACCAGAGCTACCGTCCAAAGAGCCCAGCTTCCTCCTCCACGTCCTCTGCCTTCCTTCCAACCACTCACAGCCCTTCAGGGCCTCAGCAGCCTCCGGCATCTCTCCCTGGCCTCACCGCTCAGCCTCAGCTCTCACCAAAGGAAGCGACTTCAGATCCATCCCGAACTCCGGAGGAGGAACCCTTGAACTTGGAGGGGCTAGTGGCCCACCGGGTAGCAGGGGTGCAGGCTCGGGAGAAGCAGCCTGCAGAGCCCCCGGCCCCTCTCCGGAGGCGGGCGGCCAGTGATGGACAGTATGAGAACCAGTCTTCAGAACCCTCATCTCCCCGGAGCCCTGGGGTTCGCTCCCCTGTCCAGTGCGTCTCCCCAGAGCTGGCTCTCACCATCGCTCTTAATCCTGGAGGACGGCCCAAAGAGCCCCATCTGCACAGCTACAAGGAGGCTTTTGAGGAGATGGAGGGAACCTCTCCGACCAGCCCACCGCCCAGTGGGGTGCGCTCCCCTCCAGGTCTGGCCAAGACACCCCTGTCTGCTCTGGGCCTGAAACCCCACAACCCAGCGGACATCCTGTTGCACCCCACAGGTGAGCCTCGGAGCTACGTCGAGTCGGTGGTGCGGACGGCAGTAGCTGGGCCCCGAGCTCAGGACCCTGAGCCCAAGAGCTTTAGCGCCCCAGCTGCCCAGGCCTATGGCCATGAGACGCCCCTGAGGAATGGGACCCTGGGTGGCTCCTTTGTCTCCCCCAGCCCCCTCTCCACCAGCAGCCCCATCCTCAGCGCTGACAGCACTTCAGTGGGGAGTTTCCCGTCAGGAGAGAGCAGTGACCAGGGCCCCCGGACACCCACCCAGCCTTTGCTGGATTCCGGCTTCCGCTCCGGCAGCCTGAGCCAGCCCAGCCCTTCGGCTCAGAGAAGCTACCAGAGTTCTTCTCCTCTCCCGGCCGTGGGCAGCAGCTACAGCAGCCACGACTACTCACTGCAGCAGTTCAACTCCCCAGAAAGCCAGGCCCGGGCTCAGTTTGCTGTGCCCAGCGTCCACACGGTACCCGGGAGCCCTCAGGCACGCCAGAGGACAGTGGGCACCAATACTCCCCCTAGCCCTGGCTTTGGTCGCCGAGCCATCAACCCCAGCATGGCTGCCCCTGGCAGCCCCAGTTTGAGCCACCGCCAGGTGATGGGCCCATCAGGAGCTGGTTTCCATGGTAACACAGTTTCCAGCCCCCAGAGCAGTGCAGCGACCACTCCAGGAAGCCCCAGCCGGGGCCAGCACCCTGGGGCCCACCAGGCCTCAGGCCTCCATGGCAGTGTGGTCACCACTCCAGGGAGCCCAAGCCTGGGCCGGCACCCAGGAACCCACCAGGGCAACCTGGCCCCCAGTCTCCATGGCAACACAATAGCCAGCCCCGGAAGCCCCAGCCTGGGCCGGCACCTGGGAGGATCTGGATCTGTGGTTCCCGGAAGCCCCAGCTTAGACCGGCACGTGGCCTATGGCGGCTACTCCACCCCTGAGGACCGGAGACCCACGCTGTCCCGGCAGAGCAGTGCCTCCGGCTACCAGGCTCCCTCCACGCCCTCCTTCCCTGTGTCCTCTGCCTACTACCCTGGTCTGAGTAGCCCTGCCACCTCCCCCTCGCCGGATTCAGCAGCCTTCCGGCAAGGGAGCCCAACACCGGCCTTGCCAGAGAAGCGGAGGATGTCCATGGGAGACCGGGCGGGCAGCCTCCCCAACTATGCTACCATCAACGGGAAGGTGTCCTCCTCGCCTGTCGCCAGCGGCATGTCCAGTCCCAGTGGGAGCAGCACCGTCTCCTTCTCTCATACTCTGCCTGACTTCTCCAAGTACTCCATGCCAGACAACAGCCCTGAGACCCGGGCTAAAGTGAAATTTGTCCAGGACACTTCCAAGTATTGGTACAAGCCTGAGATCTCTAGAGAGCAGGCCATCGCACTCCTGAAGGACCAGGAACCAGGGGCCTTCATCATCCGTGACAGTCACTCCTTCCGAGGGGCCTATGGGCTGGCCATGAAGGTGTCATCTCCCCCTCCGACCATTATGCAGCAGAATAAAAAAGGGGACATGACCCATGAGCTGGTGAGACATTTCCTGATAGAGACTGGCCCTAGAGGAGTCAAGCTCAAGGGGTGCCCCAATGAGCCAAACTTTGGATCCCTCTCTGCCCTGGTCTACCAGCACTCCATCATCCCACTGGCTCTGCCCTGCAAGCTGGTCATTCCAAACCGAGATCCCACAGATGAATCGAAAGATAGCTCAGGCCCTGCCAACTCAACCACTGACCTGTTGAAGCAAGGGGCAGCCTGTAACGTGCTCTTCGTCAACTCTGTGGATATGGAGTCACTCACTGGGCCACAGGCCATCTCCAAAGCCACTTCTGAGACACTGGCTGCTGACCCCACGCCGGCTGCCACCATTGTTCACTTCAAAGTTTCTGCCCAGGGAATTACACTGACTGACAACCAGAGGAAGCTCTTCTTCAGACGACACTACCCCCTCAACACTGTCACTTTCTGTGACCTGGATCCACAGGAGAGAAAGTGGATGAAGACGGAGGGAGGGGCCCCTGCTAAGCTCTTCGGCTTTGTGGCCCGGAAGCAGGGCAGCACCACGGACAACGCCTGCCACCTCTTCGCTGAGCTTGACCCTAACCAGCCTGCTTCCGCCATTGTCAACTTTGTCTCCAAGGTCATGCTGAGTGCTGGCCAGAAGAGATGAACCCACCCCTTGCCTGGGGCCAGGGCAGTGGGGATGGGGCATGTGGGGGCGGGGAGACCCATGAATCCTGACCACCTTTAAATCCAGAAGGAGGACTTTGGGCTAATTTTGGAGAAGGAGAGAAGAAAGTGCAATGTGGGGAGAGGGAAGTGAATCGCAGAGGGGAGGGGGAGAGCGGGAGAGAAAGAAAGAAAAAGATGGAGGAGGATTACTGGGATTCCTTTGGTTAGATGGATACTACGTAACCCCAAAGCCTCCCAAACTAACCAGGTCCACCTAACTCTCCCTCACCCTCCCAGAAGACAGAGTTTCTCAAAGGAGGCAGAACGGACCTCCTTGGGGATCCATGTTTTGAGGGGAATGGAAAAGCTCTGTCTCC