Transcript asmbl_14263

Sequence
Transcript Sequence for observation asmbl_14263 of TGE0000273:
GAGCGAGGCTGAACGCCTGACGTCAAGGCGACATCGCCAAACCTCGCCCAGATTCAGGCGTGTAAACCAGCCGGAGCGGCGCGGCAGCGGCAGGACCGCCGTGGCGCCTAGAGTAGCGACCCGGGGGGAGCGCGGGGCGACGCTGGCTGCAGGGACCCGGTGACAGCGTGAGAGGTTCGCAGAGTACTAGGTTTTGACAAGCTTGCATCATGCGTGAGTATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAGTCTGCTTTGACTGTACAATTTGTTCAAGGAATTTTTGTAGAAAAATACGATCCTACGATAGAAGATTCTTATAGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATCTTGGATACTGCAGGAACGGAGCAATTTACAGCAATGAGGGATTTATACATGAAAAATGGACAAGGATTTGCATTAGTTTATTCCATCACAGCACAGTCCACATTTAACGATTTACAAGACCTGAGAGAACAGATTCTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTTGTTGGTAATAAGTGTGACTTGGAAGATGAAAGAGTTGTAGGGAAGGAACAAGGTCAAAATCTAGCAAGACAATGGAACAACTGTGCATTCTTAGAATCTTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGACCTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCTCGCAAAAAGTCATCATGTCAGCTGCTTTAATATACTAAATGCATTGTAGCTCTGAGCCAGGTCTGAAGAACTGTTGCCCAATTCAACAGTGCCAGCATTCCAACTTTGTTAAACCTACCAACATCTTAAATGGACTTTCCTGTGGTGGTACCCTTTAAGAGGCGGATGAAAGCTACTATATCAGTTTGCACATTCTAATCACTTTCCAGTATCACAAGAGAGATTTTTACTTATATAATAGTCCTAGAGTTTGCAGCTGGTAAAACCAGAGGCTACATCCAGTATTACTGCTAAGAGACATTCTTCATCCACCAATGTTGTACATGTATGAAAATGGTGTACTGTATACTTTAACATGCCCCATACTTTGTATTGGAGAGTACAATAATGTAAATCCTAAAAGCACCACTATTTTAGCATAATAAAAGAAAGTCCAAAGAGCTCCTATATAGACTACTCCAGATAACTTCGCTTCTTTGATACTTGTAGCTTATTGTAATTTTTTTTAAGAAATTCAAGGTCATTATTATTGTACAAAATAAGCGCTTTGATTAACACAGCTATATAGTTTTTTTAATTTTTAAAAAACCTGTGGAGACGGTGATCTTGTCTTTAAAACATGATAGTCCTTTCAGTATAATGTCTTAGATTAAAGACGTTGCCTTTAATATCTGTTGGGAAGGAAATGTCCAGACTTTTCAAATCTCTTATTATATGTTTCCTTTTTTTGTTTACATAGGGAACAATGTTTATAGTCGTGTGTACAGTGGGGGTCTACAACAAGAAGTGTATATTTTCAAACAATTTTTTAATGATTTAACAATTTTTGTAAATCATTTTCAGGCTTCTGCAGCTGTAGATTCTCACTGTGAATCCCTTGCTTGCTCATGCATAAGTGTATTTGCAATACCAAATATACAGGTTTAGTATTTTTGCCTGTTAGTGATTGTTTCACATGTGTAACGTTTTGGTTGAGATGTTAAATGGTGGACGAGTACTGTGGATGTGAATGTGGGAAGTAATTTTAATCATATGTAATTGGTCACAAGGCCTAATTTGCAGTAACTATTGCTGTTTTATTTAACAATGCCTTGTTGCTTTGTATGCATTAATGTTTGGATGTAAAGATTGTGTGTCTATCCAACAGGGAGCCACAGTATTTAAATTGACCAACCTAATGTTACAACTACTTTGAGGTGGCCAAATGTAAACTAAAAGCCTTAATTAAAGTGGTGCAATTTTGTATAACTTAGCATCAGTAGTTCAATAAATTTGGATTGCCATGCAAGGGCTTGCATTATAATTACTTGCCACTTGAATGTGTTTTGTGTAATGTTTTAACAGTGCTAGTAAATAA