Transcript asmbl_7988

Sequence
Transcript Sequence for observation asmbl_7988 of TGE0007853:
GTCAGCCTAGGTCAGGAACATGGCCGCGCGGTCCCTATGGGCGGTCCGGTGGCGGGTACAGCGCCTCTTGTCCTCGAGTGCCGCGTCGGATGGCAGGGGATGTCTGCACCTTTTCAGCACCGCCACCCAGAGAACTGCTGGTGAGGACTGTAATTCTGAGGACCCTCCCGATGAGCTTGGGCCCTCTCTTGCAGAAAGAGCCTTAAAGCTAAAAGCTGTTAAACTAGAGAAGGAAGTCCAGGATTTAACAGTGAGATACCAGAGAGCTGTAGCTGATGGTGAAAACATAAGAAGACGAACTCAGAGATGTGTAGAAGACGCCAAGATATTTGGAATTCAGAGTTTCTGTAAGGACTTGGTAGAGGTGGCAGACATTTTGGAGAAGACTACAGAGTGCATTTCTGAAGAAACAGAGCCTGCAAACCAGAAGCTCACTCTGGAGCAGATATTCCGGGGGTTGTCACTTTTAGAAGCAAAGCTGAAAAGCGTGTTTGCCAAGCATGGCCTGGAGAAGATGACACCCATTGGTGACAAATACGACCCTCATGAGCATGAACTCATCTGTCATGTGCCAGCTGGTGTTGGGGTGCAGCCCGGCACAGTGGCATTGGTAAGGCAAGATGGCTACAAGCTTCATGGCCGCACCATTAGACTTGCCCAGGTGGAAGTGGCAGTGGAATCTCAGAGAAGACTCTGAATGGGCCATGAGGAACCAAATGTTCTTCCAGAGCGCAGTCACCTGTGTTTCCTTTATTTATTAAACTAGGTTTGTACATGAGGTACTTCATGTGATCTGTTTTGGATTTAGTCATATTGGCTTTATTTCTAAGATACTCTATTGATTTAATGTGACCTGTTCGGTCTCATCAGAAGTCTTGCCATTCGGCATTTGAACAATGTGACAAGTGTTTCTATGGCCTTTATGTTTAAGAAAATTATTTTTAAATTAGTTCTCTGAGGACTTTCAATCCAAAA