Transcript asmbl_71974

Sequence
Transcript Sequence for observation asmbl_71974 of TGE0007724:
ACGTCTGCGGGTTCCGAGAGCTCCACTCTGGTTTCAGGCGTCGTCTTGAGCTTGTTGTTCCGTGCCGTGGGAGTGACGGGGAGTCTTCTGGCAGAATTGAGAGTGGACCGTTTTAAGTTGGCTGTGGGTCCAGGAATAGCCTTGGAACCAAAATGGGACATGAGTTGAAGACAATCTAATCTCTGCCCTGAATCTGTTCTAGAGTGGACAATACATGGATTTAGATGCTGTTACAAAACACTCAGCATTACATGCAAAGCCCAATGGACTCATTCTTCAATATGGGACTGCTGGATTTCGAATGAAAGCAGAACATCTTGATCATGTCATGTTTCGCATGGGATTGTTAGCTGTCCTGAGGTCAAAATATACAAAATCTACAATAGGAGTCATGGTAACAGCATCACACAATCCTGAGGAAGACAATGGTGTCAAATTGGTTGATCCTTTGGGTGAAATGTTGGCACCTTCCTGGGAGGAACATGCTACCTGTTTGGCAAATGCTGAGGAAGAAGATATGCAGAGTGTGTTGATGGACATCAGCGAGAAAGCAGCGGTAGATCTGCAACAAGATGCCTTCGTAGTGATTGGTAGAGATACCAGGCCCAGCAGTCAGAAACTTTCACAGTCTGTAATAGATGGTGTCACTGTTTTGGGAGGTCAGTTCCATGATTATGGCTTGTTAACAACACCCCAGCTGCACTACATGGTATACTGTCGAAATACGAATGGGCAATATGGAAAGGCAACCATAGAAGGTTACTACCAGAAGCTCTCTAAGGCTTTTGTGGAACTTACCAAACAGGCTTTCTGCAGTGGAGATGAATATCGATCACTTAAGGTTGACTGTGCAAATGGCATAGGGGCCTTGAAGCTAAGAGAAATGGAATACTACTTCTCCCAGGAGCTGTCAGTTCAGCTGTATAATGATGGGACCAAAGGGAAACTCAATCATTTATGTGGGGCTGACTTTGTGAAAAGTCATCAGAAACCTCCACAAGGAATGGAAATGAAGTCCAATGAAAGATGTTGTTCCTTTGATGGAGATGCAGACAGAATTGTTTATTATTATCATGATGCAGATGGCCACTTTCATCTCATAGATGGTGACAAGATAGCAACTCTCATTAGCAGTTTCCTTAAAGAGCTCCTATTGGAGATTGGGGAAAGTTTGAATATTGGTGTTGTACAAACTGCATATGCAAATGGAAGTTCAACACGCTATCTTAAAGAAGTTATGAAGGTACCTGTCTATTGTACTAAAACTGGTGTAAAACATTTGCACCACAAGGCTCAAGAGTTTGATATTGGAGTTTATTTCGAAGCAAATGGTCATGGCACAGTACTGTTTAGTAAAGCTGCTGAAATGAAGATAAGAGAACTAGCAAAAGAATTAGAAGATAAGAAAAGGAAAGCTGCTAAGATGCTTGAAAACGTTATTGACTTGTTTAACCAGGCAGCTGGTGATGCTATTTCTGACATGCTGGTGATTGAGGCAATCTTGGCTCTGAAAGGCTTGACTGTACAACAGTGGGATGCTCTCTATACGGATCTTCCAAACAGACAGCTCAAAGTTAAGGTTGCAGACAGGCAACTTATTAGCACCACTGATGCTGAAAGGCAAGCAGTTACACCCCCAGGACTACAGGAGGCAATCAATGACCTGGTGAAGAAGTACGAGCTTTCCCGAGCTTTTGTCCGGCCATCTGGTACAGAAGACATAGTCCGAGTATATGCAGAAGCAGACTCACAAGAAAGTGCGGATAGCCTTGCATATGAAGTGAGCGTGGCAGTATTTCAGCTGGCTGGAGGAGTTGGAGAAAGTCCCCAACCAGGTTTCTGAAGACAGTTTTTATATTTATGAGAAACTGGATTTTTAAAAAGTTTTTACAAAATACTGCCATTATTGTGACAGTTCCAAACACATTTATAATCATAACGTTTACAGTGCACCTTACTGGATTGTTTCTAGATGATTGCTTTTCTTAAACACTACCAGAATAATACTTTAGAGATAGCTAAGCCTTATACTTGTTAAATTCAGTTTAAAAATGAAACCTACTTCTAGTTTCACCAATGTAAACTATTGGAGCTTATGTACATGATTCAGTCATTAATTTTTTAATATATGCTGGGAAAAAATCTTA