Transcript asmbl_711

Sequence
Transcript Sequence for observation asmbl_711 of TGE0007654:
CTTTAAAGTCGTTGTCGCCGCACCCCGGACGTCCCGCTGACCGCGTGCGTGCTTCTGAGAAATGTCTACCAACGAGACAGAAGCCCCTGCCAACACCCATGTGACAGCAGAAGAACCGGTACAGCAGCCCAGCGTGGTGGACCGCGTGGCCCACATGCCCCTTATCGGTGCCACCTGTAATATGGTGTCCGCGGCCTACACCTCCACCAAGGAGAGCCACCCCCACGTCAAGACCGTCTGCGAAGCGGCGGAAAAAGGTGTGAAGACCCTCACAGAGGCTGCCATCAGCGGGGCCCAGCCCATCCTGTCCAAGCTGGAGCCTCAGATCGCATTGGCCAGTGAATACGCCCACAAGGGGCTGGATAAGCTGGAGGAGAACCTGCCCATCCTGCAGCAGCAGACGGAGAAGGTCCTGGCAGACACCAAGGAACTCGTGTCATCTAAGGTATCGGGGGCCCGAGACGCCATGTCCAGCACGGTGTCCAGCGCCAAGGACGCAGTGGCCGCCCGAGCGACAGGGGCAGCAGATGCGACCCGGGAAGCCATGCAGAGTGGCGTGGACATGACCAAGTCGGTGGTGACCAACAGTGTCCAGTTGGTGGGCCAGATGGTGCTGAGCGGGGTGGATACGGTGCTGGGCAAGTCGGAGGAGTGGGCGGACAACCACCTGCCCATGACGGACTCCGAGCTGGGTGAGTGTGGCCCGCGGGCCAGCCCCCACCCCGACACCCCCACGCAGAGTCCGTCGGTTTGAATGACATTTAAATGAACAAATAAATGGCCGGTGGGTGAGGGGAAGAA