Transcript asmbl_70703

Sequence
Transcript Sequence for observation asmbl_70703 of TGE0007598:
CGAGAGCGAGGCGACGGAAGTGGCCCCTTTACTGTTTGTCCGTGCGCAGGCGTTATTCTATTCTCTTGCTGCTGCTCTTCAGGCGCTTCTTTTCCCTCTCTTCTCTCTTCTCCACGCGAGGGGGTGCGCGTACCCTTAGTCGTGGTCGCGCACTCAGCCCCTGTGCTACTCTCGTGGCACTTTCATCATGGCGGGCATCCTGTTTGAGGATATTTTTGATGTAAAAGACATTGACCCGGAGGGCAAGAAGTTTGACCGAGTGTCTCGACTGCATTGTGAGAGCGAATCTTTCAAGATGGACCTTATCTTAGATGTAAACATTCAGATTTACCCTGTAGACTTGGGTGACAAGTTCCGGTTGGTCATAGCCAGTACCTTGTATGAAGATGGTACCCTGGATGATGGTGAATACAACCCCACAGATGACAGACCTTCCAGGGCTGACCAATTTGAGTATGTAATGTATGGGAAAGTGTACAGGATTGAGGGAGACGAAACTTCTACTGAAGCAGCAACACGTCTCTCTGCCTACGTCTCGTATGGGGGCCTGCTCATGAGGTTGCAGGGTGATGCCAATAACCTGCATGGATTTGAAGTGGATTCCAGAGTTTATCTGCTGATGAAGAAACTGGCCTTCTGAACCACCTGGGAAGCCAATCTTGCTGCTTAGTCACTTAGGTCATGGACATTCATTCAAGTCTGAGCAGCAGTTGCTGTTGTTCACCTGTCTAAGAGGGGCTGGATTTGTGTTGATTGTGCCGTGCATCTTTAGGTGGTGTCTGAACTCAATGGGAAGTTGACTTGCTTGTGAAAGACCCAGTGGGAGGGCTTAAAAGGAATAAGAAGTTGTTGTGTGTATATGATTTTTTAAATTAAACTTTACTTTCTCAGA