Transcript asmbl_52751

Sequence
Transcript Sequence for observation asmbl_52751 of TGE0002707:
CGTGACCGGAGGAGGCGGGAGCTCAGGACCGGCGCCTTCTCCTTGCTTCTGGGGGTCGTGGCCTTGCTCCCGCTGTGCGGGAAAAGAATCCAGGCCCTTCCACGCGCGTGTGGGTGCGGGGGCCCCGAAGTGCTCGTGGTTCCCCGCTAGGTCTCCGCTGGGGCAGGAACCGGAATCATGGGTGGGACCACCAGCACCCGCCGGGTCACCTTCGAGGCGGACGAGAATGAGAACATCACCGTGGTGAAGGGCATCCGGCTTTCGGAAAATGTGATTGATCGAATGAAGGAATCCTCTCCATCTGGTTCGAAGTCTCAGCGGTATTCTGGTGCTTATGGTGCCTCAGTTTCTGATGAAGAATTGAAAAGAAGAGTAGCTGAGGAGCTGGCATTGGAGCAAGCCAAGAAAGAATCCGAAGATCAGAAACGACTAAAGCAAGCCAAAGAGCTGGACCGAGAGAGGGCTGCTGCCAATGAGCAGTTAACCAGAGCCATCCTTCGGGAGAGGATATGTAGCGAGGAGGAACGCGCTAAGGCAAAGCACCTGGCTAGGCAGCTGGAAGAGAAAGACCGAGTGCTAAAGAAGCAGGATGCATTCTACAAAGAACAGCTGGCTAGACTGGAGGAGAGGAGCTCAGAGTTCTACAGAGTCACCACTGAACAATATCAGAAAGCTGCTGAAGAGGTGGAAGCAAAGTTCAAGCGATATGAGTCTCATCCAGTCTGTGCTGATCTGCAGGCCAAAATTCTTCAGTGTTACCGTGAGAACACCCACCAGACCCTCAAATGCTCCGCTCTGGCCACCCAGTATATGCACTGTGTCAATCATGCCAAACAGAGCATGCTTGAGAAGGGAGGATAAAAACTTTCAGAATGAGCAAAACACCATCAACGTTAATTCCAGAGATGGAACATTTTTTTTCCTAGTGAGAAAACAACCCATTTGAAGAGAAGACCACTAATGAGAAGACCACTAAAGAGAGACATCAAGAATGGATTCAGCAGAATCATTTCACGTTTTGAACAGCAGCAGTTTGAAGGGCCAAAGCCTTGATCAGGGATCAGTCATTAAAGGACACTCTTGAGTATTAGTAAACCCTCTTATGATGATTAAAAGAGAAGGGCAGCCCTCTCCACCTTTTGGTACTTTCTATTCAACTTGCACTGACCATAAAATGTTTCTCTTCTGAACAAGCCCCATCATTTGGTGAACCTCCACCCTAACAAAGTAGGATGGGGTTGGGGGCTAAATTAATTGGAGTGGGGCGAGGAGAGAGCCAGAAAACATAGATCCGAGGGCAGCAGTGCTGGGTGGAGAGAGCCAGAAAACAGATCTGGAGGCAGCAGTGCTGGATGGAATTGTCTAGGCTGTGGCATGTTGGTTTTGTCTTTCTTTTCTCCTTTGATTATGTAAGAGCTATTTCATTATAACTTATTATGGTGATTATACAGGCAAGAAGACAAAAAGGAGAGAAAATGTACCTCTTCTACTGGAATAATGTTTATGATTACAAGTGAGATAAGGTATTTTTATCAATATGAAGGCAACCTTGGCTGATAAAACCTCTATAGTGAATACTCACATCTTTACTTCACTCACTATCAATAATAAATATATTTTCTGACAAAGACTGGCATTGTAG