Transcript asmbl_14218

Sequence
Transcript Sequence for observation asmbl_14218 of TGE0000269:
AGTGCGCCCGCCGGAGGGTGTTTATCGCGGCTAGAGAGATGTCGCTGCTGCGGTCGCTGCGCGTGTTTCTGGTCGCGCGGACCGGGAGCTACCCGGCTGGGTCTCTTCTGCGTCAGTCGCCCCAGCCAAGGCACACATTTTATGCTGGGCCCCGTCTGTCTGCCTCGGCCTCCAGCAAGGAGCTCCTCATGAAGCTGCGGCGGAAAACAGGCTACTCCTTTGTAAATTGCAAGAAAGCTCTGGAGACTTGTGGCGGGGACCTCAAACAGGCAGAGATCTGGCTCCACAAGGAGGCCCAGAAGGAGGGCTGGAGCAAAGCTGCCAAGCTCCAAGGGAGGAAGACCAAAGAAGGCCTGATTGGGCTGTTGCAGGAAGGAAACACAACTGTATTAGTAGAGGTAAACTGTGAGACAGATTTTGTTTCTAGAAATTTAAAATTTCAACTGTTGGTCCAGCAAGTAGCCCTTGGAACCATGATGCATTGTCAGACCCTAAAGGATCAACCCTCTGCATACAGTAAAGGTTTCTTGAATTCCTCTGAGCTTTCTGGACTTCCAGCTGGGCCTGACAGAGAAGGCTCACTCAAGGATCAGTTGGCTTTAGCAATTGGAAAACTGGGAGAAAACATGATTCTTAAACGAGCTGCATGGGTGAAGGTGCCATCTGGGTTCTACGTTGGCTCTTATGTCCACGGAGCAATGCAGAGTCCCTCACTTCACAAGCTGGTGCTGGGGAAGTATGGGGCCCTGGTCATCTGTGAGACGTCTGAACAGAAAACAAACCTTGAAGACGTTGGCCGCCGCCTTGGGCAGCATGTGGTGGGCATGGCCCCCCTCTCTGTTGGCTCCCTGGACGATGAGCCTGGGGGAGAGGCAGAGACTAAGATGCTGTCCCAGCCGTATTTGCTGGATCCCTCCATTACCTTGGGGCAGTATGTGCAGCCTCAGGGGGTGTCGGTAGTAGACTTTGTGCGGTTTGAATGTGGAGAAGGTGAAGAGGCAGCAGAAACTGAATAGGTTCCAGAGACTTTTGGCCCAGGAGGAATATTTACTTTTAGCTCTGGACATCATTACAAAAAGGAATATTTCCCAAACCTCTTCAGACCGAGAATGCATGGGTAAAATTATTAAATAGTTGTATAATAAAAATAATTTTTTCCTTGTTTGCGTAATACTGGATTTAGCTTTTCTGTGCCTTTCAAAAACAACAGGTGGGCCTTATTGACGTGATAGTGTCGTGGAGAACAGGCATCAACAATACTGCTGCTCCCTTCAACATAGATTTATTATGGTATTTCTGAAATTTCT