Transcript asmbl_68721

Sequence
Transcript Sequence for observation asmbl_68721 of TGE0007456:
GCCCCGCGCAGCGCGGCTGTGTTTGCGTTGCGGCCTGTGCGAGTAGTCGCTTCGGAACCAGTCTCCCGGCGAGCGGCGCGCAGAAACCTCGAACCGGTGGAGCCCACTCGTAACCTGGAGCCCATAAGGCCGCGAAGACAGTACCTTTTCCTTAGCGGCGGACTGCTGCAGTAAGAATGTCTTTCCCCCCTCATTTGAATCGCCCTCCCATGGGAATCCCAGCACTCCCACCAGGGATCCCACCCCCACAGTTTCCTGGCTTTCCTCCACCTGTACCTCCAGGAACCCCAATGATTCCTGTACCAATGAGCATTATGGCTCCTGCTCCAACTGTCTTAGTACCCACTGTGTCCATGGTTGGAAAGCATTTGGGAGCAAGAAAAGATCATCCAGGCCTAAAGACTAAAGAAAATGATGAAAATTGTGGTCCCACTACTACGGTTTTTGTTGGCAACATTTCTGAGAAAGCCTCAGACATGCTTATAAGACAGCTCCTTGCTAAATGTGGCTTGGTTTTAAGCTGGAAGAGAGTACAAGGTGCATCTGGAAAACTTCAAGCCTTCGGATTCTGTGAGTATAAGGAGCCTGAATCTACCCTCCGTGCACTCAGGTTATTGCATGACCTACAGATTGGAGAGAAAAAGCTACTTGTTAAAGTTGATGCAAAGACAAAGGCACAACTGGATGAATGGAAAGCAAAGAAGAAAGCTTCTAATGGGAATGCCAGGCCAGAAACTGTCACTAATGATGATGAAGAAGCCTTAGATGAAGAAACTAAGAGAAGAGATCAAATGATCAAAGGGGCCATTGAAGTTTTAATACGAGAATACTCCAGCGAGCTCAATGCCCCTTCACAAGAATCTGACTCTCATCCCAGGAAGAAGAAAAAGGAAAAGAAGGAGGACATTTTCCGCAGATTTCCGGTGGCACCACTGATCCCTTATCCGCTCATCACTAAGGAGGATATAAATGCTATAGAAATGGAAGAAGACAAAAGAGACCTGATATCCCGAGAAATCAGCAAATTCAGAGACACACACAAGAAACTGGAAGAAGAGAAAGGCAAAAAAGAAAAAGAAAGACAGGAAATTGAGAAAGAACGGAGAGAAAGAGAGAGGGAGCGTGAAAGGGAACGAGAAAGGCGAGAACGGGAACGAGAAAGAAAAACGTGAACGAGAAGGAGAAGGAACGGGAGCGGGAACGAGAACGGGATAGGGATCGTGACCGGACAAAGGAGAGAGATCGAGATCGGGATCGAGAGAGAGATCGGGACCGCGATCGTGAGAGGAGCTCAGATCGAAATAAGGATCGGAGTCGATCTAGAGAAAAGAGCAGAGATCGTGAAAGGGAACGAGAGCGAGAAAGAGAAAGAGAGCGAGAACGAGAACGAGAGAGAGAACGTGAGCGAGAGAGAGAGCGAGAAAGGGAACGAGAGCGTGAGAGAGAGAAAGACAAGAAGAGAGACCGAGAAGAGGATGAAGAAGATGCATATGAACGAAGAAAACTTGAAAGAAAACTTCGAGAGAAAGAAGCTGCTTATCAAGAGCGCCTTAAGAATTGGGAAATTAGAGAACGGAAGAAAACCCGGGAGTATGAGAAAGAGGCTGAAAGAGAAGAAGAAAGAAGAAGAGAAATGGCAAAAGAAGCTAAACGACTAAAAGAATTCTTAGAGGATTATGATGATGATAGAGATGATCCCAAATATTACAGAGGAAGTGCTCTTCAGAAAAGATTGCGTGATAGGGAAAAGGAAATGGAAGCAGATGAACGGGATAGGAAAAGAGAGAAGGAAGAGCTAGAGGAAATCAGGCAGCGCCTTCTGGCAGAAGGGCACCCGGATCCAGATGCAGAGCTCCAGAGGATGGAACAAGAGGCTGAGAGGCGCAGACAACCACAAATAAAGCAAGAACCAGAATCTGAGGAAGAAGAAGAAGAAAAACAAGAAAAAGAGGAAAAACGAGAAGAACCCATGGAAGAGGAAGAAGAGCCAGAGCAGAAACCCTGTCTCAAACCAACTCTGAGGCCCATCAGTTCTGCTCCATCTGTTTCCTCTGCCAGTGGCAATGCAACCCCCAACACTCCTGGGGATGAGTCTCCCTGTGGTATTATTATTCCTCACGAAAATTCGCCAGATCAACAACAACCTGAGGAGCATAGGCCAAAAATAGGACTAAGTCTTAAACTGGGTGCTTCCAATAGTCCTGGTCAGCCTAATTCTGTGAAGAGAAAGAAACTCCCCGTAGATAGTGTCTTTAACAAATTTGAGGATGAAGACAGTGATGATGTACCCCGAAAAAGGAAACTGGTTCCCTTGGATTATGGTGAAGATGATAAAAATGCTGCCAAAGGCACTGTAAACACTGAAGAAAAGCGCAAACATATTAAGAGTCTCATTGAGAAAATCCCCACAGCCAAACCAGAGCTCTTTGCATATCCCCTGGATTGGTCTATTGTGGATTCTATATTGATGGAACGACGAATTAGACCATGGATTAATAAGAAAATTATAGAATAC