Transcript asmbl_14191

Sequence
Transcript Sequence for observation asmbl_14191 of TGE0000268:
CTTTCCGGTAGCGGTGCCAGGGCAGTGGCCTAATACGGAACTCCATTTCCCGGCGTGCCTCGCGGAGGCCGCTGAACTCAGAAGCGGGAGGCCGGTTCCGGTTGCATCAGCGAGGGATTCACGGCGAAATGAGACTGTTCGTGAGTGATGGCGTCCCGGGTTGCTTGCCGGTGCTGGCCGCCGCCGGGAGAGCCCGGGGCAGAGCAGAGGTGCTCATCAGCACTGTAGGCCCGGAAGATTGTGTGGTCCCGTTCCTGACCCGGCCTAAGGTCCCTGTCTTGCAGCTGGATAGCGGCAACTACCTCTTCTCCACTAGTGCAATCTGCCGATATTTTTTTTTGTTATCTGGCTGGGAGCAAGATGACCTCACTAACCAGTGGCTGGAATGGGAAGCGACAGAGCTGCAGCCAGCTTTGTCTGCTGCCCTGTACTATTTAGTGGTCCAAGGCAAGAAGGGGGAAGATGTTCTTGGTTCAGTGCGGAGAGCCCTGACTCACATTGACCACAGCTTGAGTCGTCAGAACTGTCCTTTCCTGGCTGGGGAGACAGAATCTCTAGCCGACATTGTTTTGTGGGGAGCCCTATACCCATTACTGCAAGATCCCGCCTACCTCCCTGAGGAGCTGAGTGCCCTGCACAGCTGGTTCCAGACACTGAGTACCCAGGAACCATGTCAGCGAGCTGCAGAGACTGTACTGAAACAGCAAGGTGTCCTGGCTCTCCGGCCTTACCTCCAAAAGCAGCCCCAGCCCAGCCCCGCTGAGGGAAGGGCTGTCACCAATGAGCCTGAGGAGGAGGAGCTGGCTACCCTATCTGAGGAGGAGATTGCTATGGCTGTTACTGCTTGGGAGAAGGGCCTAGAAAGTTTGCCCCCGCTGCGGCCCCAGCAGAATCCAGTGTTGCCTGTGGCTGGAGAAAGGAATGTGCTCATCACCAGTGCCCTCCCTTACGTCAACAATGTCCCCCACCTTGGGAACATCATTGGTTGTGTGCTCAGTGCCGATGTCTTTGCCAGGTACTCTCGCCTCCGCCAGTGGAACACCCTCTATCTGTGTGGGACAGATGAGTATGGTACAGCAACAGAGACCAAGGCTCTGGAGGAGGGACTAACCCCCCAGGAGATCTGCGACAAGTACCACATCATCCATGCTGACATCTACCGCTGGTTTAACATTTCGTTTGATATTTTTGGTCGCACCACCACTCCACAGCAGACCAAAATCACCCAGGACATTTTCCAGCAGTTGCTGAAACGAGGTTTTGTGCTGCAAGATACTGTGGAGCAACTGCGATGTGAGCACTGTGCTCGCTTCCTGGCTGACCGCTTCGTGGAGGGCGTGTGTCCCTTCTGTGGCTATGAGGAGGCTCGGGGTGACCAGTGTGACAAGTGTGGCAAGCTCATCAATGCTGTCGAGCTTAAGAAGCCTCAGTGTAAAGTCTGCCGATCATGCCCTGTGGTGCAGTCGAGCCAGCACCTGTTTCTGGACCTGCCTAAGCTGGAGAAGCGACTGGAGGAGTGGTTGGGGAGGACATTGCCTGGCAGTGACTGGACACCCAATGCCCAGTTTATCACCCGTTCTTGGCTTCGGGATGGCCTCAAGCCACGCTGCATAACCCGAGACCTCAAATGGGGAACCCCTGTACCCTTAGAAGGTTTTGAAGACAAGGTATTCTATGTCTGGTTTGATGCCACTATTGGCTATCTGTCCATCACAGCCAACTACACAGACCAGTGGGAGAGATGGTGGAAGAACCCAGAGCAAGTGGACCTGTATCAGTTCATGGCCAAAGACAATGTTCCTTTCCATAGCTTAGTCTTTCCTTGCTCAGCCCTAGGAGCTGAGGATAACTATACCTTGGTCAGCCACCTCATTGCTACAGAGTACCTGAACTATGAGGATGGGAAATTCTCTAAGAGCCGCGGTGTGGGAGTGTTTGGGGACATGGCCCAGGACACGGGGATCCCTGCTGACATCTGGCGCTTCTATCTGCTGTACATTCGGCCTGAGGGCCAGGACAGTGCTTTCTCCTGGACGGACCTGCTGCTGAAGAATAATTCTGAGCTGCTTAACAACCTGGGCAACTTCATCAACAGAGCTGGGATGTTTGTGTCTAAGTTCTTTGGGGGCTATGTGCCTGAGATGGTGCTCACCCCTGATGATCAGCGCCTGCTGGCCCATGTCACCCTGGAGCTCCAGCACTATCACCAGCTACTTGAGAAGGTTCGGATCCGGGATGCCTTGCGCAGTATCCTCACCATATCTCGACATGGCAACCAATATATTCAGGTGAATGAGCCCTGGAAGCGGATTAAAGGCAGTGAGGCTGACAGGCAACGGGCAGGAACAGTGACTGGCTTGGCAGTGAATATAGCTGCCTTGCTCTCTGTCATGCTTCAGCCTTACATGCCCACGGTTAGTGCCACAATCCAGGCCCAGCTGCAGCTCCCACCTCCAGCCTGCAGTATCCTGCTGACAAACTTCCTGTGTACCTTACCAGCAGGACACCAGATTGGCACAGTCAGTCCCTTGTTCCAAAAATTGGAAAATGACCAGATTGAAAGTTTAAGGCAGCGCTTTGGAGGGGGCCAGGCAAAAACGTCCCCGAAGCCAGCAGTTGTAGAGACTGTTACAACAGCCAAGCCACAGCAGATACAAGCGCTGATGGATGAAGTGACAAAACAAGGAAACATTGTCCGAGAACTGAAAGCACAAAAGGCAGACAAGAACGAGGTTGCTGCGGAGGTGGCGAAACTCTTGGATCTAAAGAAACAGTTGGCTGTAGCTGAGGGGAAACCCCCTGAAGCCCCTAAAGGCAAGAAGAAAAAGTAAAAGACCTTGGCTCATAGAAAGTCACTTTAATAGATAGGGACAGTAATAAATAAATGTACAATCTCTATATACAAGCTGAGACCTTTCCTTTTGTCTACTCCAAGC