Transcript asmbl_66825

Sequence
Transcript Sequence for observation asmbl_66825 of TGE0007389:
CTCGTAACGGACGAGCGTCTGTGGAGAAGCGGCTTTCTCTCTTATTGTCTCGTGGGCCCCGCTGGTTTAGTTGCTTGCAGGGTTCTCGAGCCCTTTCACGACCGTCACCATGGAGGTGTCACCACTGCAGCCTGTAAATGAAAATATGCAAATCAACAAAACAAAGAAAAATGAAGATGCTAAGAAAAGACTGTCTATTGAAAGAATCTATCAAAAGAAAACACAGTTGGAACACATTTTGCTCCGTCCAGACACTTACATTGGCTCTGTGGAATTAGTGACCCAGCAAATGTGGGTTTACGATGAAGATATTGGCATTAACTATAGGGAAGTCACTTTCGTTCCTGGTTTATACAAAATCTTTGATGAGATTCTAGTCAATGCTGCAGACAACAAACAAAGAGACCCAAAAATGTCTTGTATTAGAGTCACAATTGACCCGGAAAACAATTTAATTAGTATATGGAATAATGGAAAAGGTATTCCTGTTGTTGAACACAAAGTTGAGAAGATGTATGTCCCAGCTCTCATCTTTGGACAGCTCCTAACTTCTAGTAACTATGATGATGATGAAAAGAAAGTAACAGGTGGTCGAAATGGCTATGGAGCCAAATTGTGTAACATATTTAGTACCAAATTTACTGTGGAAACAGCCAGTAGAGAATACAAGAAAATGTTCAAACAGACGTGGATGGATAACATGGGGAGAGCTGGTGAGATGGAACTCAAGCCCTTTAATGGAGAAGATTATACATGTATTACCTTCCAGCCTGATTTGTCTAAGTTTAAAATGCAGAGCCTTGACAAAGATATTGTTGCACTGATGGTTAGAAGAGCATATGATATTGCTGGATCCACTAAAGATGTCAAAGTCTTTCTCAATGGAAATAAGTTGCCAGTGAAAGGATTCCGTAGCTATGTGGATATGTATTTGAAGGATAAAGTAGATGAAACTGGCAATCCATTGAAAATCATCCACGAACAAGTAAACCACAGGTGGGAAGTGTGTTTAACAATGAGTGAAAAAGGCTTTCAGCAAATTAGCTTTGTCAACAGCATTGCTACTTCCAAGGGTGGCAGACATGTTGATTATGTAGCTGATCAGATTGTGACTAAACTTGTTGATGTTGTGAAGAAGAAGAACAAGGGCGGTGTTGCAGTAAAAGCACATCAGGTGAAAAATCACATGTGGATTTTTGTGAATGCCTTAATTGAAAACCCAACCTTTGACTCTCAGACAAAAGAAAACATGACTTTACAAGTCAAGAACTTTGGATCAACATGCCAACTAAGTGAAAAATTCATCAAAGCTGCAATTGGCTGTGGTATTGTAGAAAGCATACTAAACTGGGTGAAGTTTAAGGCTCAAATCCAGTTAAACAAGAAGTGTTCCGCTGTGAAACATAACAGAATCAAGGGTATTCCCAAACTTGATGATGCCAATGATGCAGGGGGCCGAAACTCCACTGAGTGTACACTTATCCTGACCGAGGGAGACTCAGCTAAAACTTTGGCTGTTTCAGGCCTTGGTGTGGTTGGGAGAGATAGATATGGGGTTTTCCCTCTTAGAGGAAAAATACTCAATGTTCGAGAAGCTTCTCATAAACAGATAATGGAAAATGCCGAAATTAACAATATCATCAAGATTGTGGGTCTTCAATACAAGAAAAACTATGAAGATGAAGATTCATTGAAGACTCTTCGTTATGGGAAGATAATGATTATGACAGATCAGGACCAAGACGGTTCCCATATCAAAGGCTTGCTGATTAATTTTATCCATCACAACTGGCCCTCTCTTCTGCGACATCGTTTTCTGGAGGAATTTATCACTCCCATTGTAAAGGTGTCTAAAAACAAGCAAGAAATGGCATTCTATAGTCTGCCTGAATTTGAAGAATGGAAGAGTTCTACACCAAATCATAAAAAATGGAAAGTCAAGTATTACAAAGGTTTGGGCACCAGCACATCAAAAGAAGCTAAAGAATACTTTGCAGATATGAAAAGACATCGTATCCAGTTCAAATATTCTGGTCCTGAAGATGATGCTGCAATCAGCCTGGCCTTTAGCAAAAAACAGATAGATGATCGAAAGGAATGGTTAACTCATTTCATGGAGGATAGAAGACAACGAAAGTTACTTGGCCTTCCTGAGGATTACTTGTATGGGCAAACAACCACATATCTGACCTACAATGACTTCATAAACAAGGAACTAATCCTGTTCTCAAATTCTGATAACGAGAGATCTATCCCGTCTATGGTGGATGGTTTGAAACCAGGTCAGAGAAAGGTTTTGTTTACGTGTTTCAAACGGAATGACAAGCGAGAGGTGAAGGTAGCCCAGTTAGCTGGGTCAGTGGCTGAGATGTCCTCTTATCATCATGGTGAGATGTCACTAATGATGACCATTATCAATTTGGCTCAGAATTTTGTGGGTAGCAATAATCTGAACCTCTTGCAGCCCATTGGTCAGTTTGGTACCAGGCTGCATGGTGGCAAGGATTCTGCTAGTCCTCGATACATCTTCACAATGCTCAGCCCTTTGGCTCGGTTGTTATTTCCACCACAAGATGATCACACATTAAAGTTCTTATATGATGACAACCAGCGTGTGGAGCCTGAGTGGTACATTCCTATTATACCCATGGTGCTGATAAATGGTGCTGAAGGAATTGGTACTGGGTGGTCCTGCAAAATTCCCAACTTTGATATTCGTGAAGTCGTGAATAATATCAGGCTTTTGATGGATGGAGAAGAACCTTTGCCAATGCTTCCCAGTTACAAGAACTTCAAGGGTACTATTGAAGAGCTGGCTCCAAATCAGTATGTGATTAGTGGTGAAGTGGCTATTCTTAATTCCACAACCATTGAAATCTCAGAGCTTCCCATCAGAACATGGACCCAGACATATAAAGAACAGGTTCTGGAACCAATGTTGAACGGCACAGAGAAGACACCTCCTCTTATAACAGATTATAGGGAATACCATACAGATACCACTGTGAAGTTTGTTGTGAAAATGACTGAAGAAAAACTGGCAGAGGCCGAGAGAGTGGGACTACACAAAGTCTTCAAACTCCAAACTAGTCTCACATGCAACTCTATGGTGCTTTTTGACCACGTAGGCTGTTTAAAGAAATATGACACAGCGTTGGATATTCTAAGAGACTTCTTTGAACTCAGGCTTAAATATTATGGATTAAGAAAAGAATGGCTTCTAGGAATGCTTGGCGCTGAATCTGCTAAACTGAACAATCAGGCTCGCTTCATCTTAGAGAAAATAGATGGCAAAATAATCATTGAAAATAAGCCTAAGAAAGAATTGATTAAAGTTTTGATTCAGAGAGGATATGATTCGGATCCTGTGAAAGCTTGGAAAGAAGCCCAGCAAAAGGTTCCAGATGAAGAAGAAAACGAAGAGAGCGATAATGAAAAGGAAACTGAAAAGAGTGACTCTGTAACTGGACCAACCTTCAACTACCTTCTTGATATGCCTCTTTGGTATCTTACCAAGGAAAAGAAAGATGAACTATGCAAATTAAGAAAGGAAAAAGAACAAGAGCTAGAAACATTAAAGAAAAAGAGTCCATCAGATTTGTGGAAAGAAGACTTGGCTGCTTTTATTGAAGAGCTGGAGACTGTTGAAGCCAAGGAAAAACAAGATGAACAAGTAGGACTTCCTGGGAAAGGGGGGAAAGGAAAAGGGAAAAAAACACAAATGGCTGAAGTTTTGCCTTCACCAAGTGGAAAAAGAGTCATTCCCCGAGTTACCATAGAGATGAAAGCAGAGGCAGAAAAGAAAATTAAAAGGAAAATTAAGAATGAAAATTCTGAAGGAACTCCTCAAGAGAATGGTATGGAACCCGAAAGCCTAAAACAAAGATTAGAGAAGAAACTGAAAAAAGAACCAGGTACCAAGACGAAGAAACAAACTACATTGCCATTTAAACCAGTCAAAAAAGGAAAGAAGAGAAACCCCTGGTCTGATTCAGAATCAGATGCGAGCAGTAACGAAAGTGATTTTGATGTCCCTCCACGAGAAATAGAGCCACGGAGAGCAGCAACAAAAACCAAATTCACAGTGGATTTAGATTCAGATGAAGATTTCTCAGATTTTGATCAAGAAACTCAAGATGAAGATTTTGTGCCATCTGATGCTAGTCCAGTTAAGACCAGAACTTCCCCGAAACGTGCTAACAAAGAACTGAAGCCACAGAAGAGCACCACGTCAGTAACGGACTTTGATGCTGATGATGCCAAGGACGATGTTCCACTTTCTCCAAGTTCTCCTGCTGCTGATTTCCCAGCCGAAACAGAAATTGTAAACCCTGTTTCTAAAAAGAACGTGACAGTGAAGAAGACGGCAGCAAAAAGTCAGTCTTCCACCTCGACTACAGGTGCCAAAAAAAGGGCTGCACCAAAAAGAACCAAAAAGGATCCAGGCGTGAATTCTGATGCCCCTCAAAAGCCTGATCCCCCCAAAACCAAGACTCGCCGCAAAAGAAAGCCATCCACTTCTGATGATTCCGACTCTAACTTTGAGAAAATGATTTCTAAAGCAGTCACAAGCAAGAAATCCAAGGGGGAGAGTGATGACTTCCACCTGGACTTAGACTCAGCTGTGGCTCCTCGTGTAAAATCTGGGCGGGCAAAGAAGCCGATAAAGTACCTTGAAGAATCAGATGAAGATGATCTGTTTTAAAATGTGAGGTGACTATTTTTAGTGGTCTTATTGAGCCCAAGACTGGTTTGAATCTCTTAATTTCCTCCCCTTTAAATTTAGTTTGGGGAAAGTAGTTTTGATCTAAAATCACCAAAGTGAAGTATGTAGAGCCCAGCGTCCCTTATCTTTTTATGATACAGTCTAAATGGTGATACATCTCATGGGCATTGTTTTTTTCTCTGCTTTGTCTGTATTTTCATTCTGTTTCCTTTTGTCTTTAAAATCTGATTTTAACTTCTGGACTCCAGAGATAGTTATGTGGTCATTCCAGCATAATGTAGTTTGTTTATTGACCATACATTAAGCTAAAATTGGAGCACTTTGATATAAAAGTGTCTACTGTGCCTCCTTTCTTACCTTCATAAATATGAGATAGAGCATGATTAATTCTGTTTTATCTTAGTTATATAGGTAATTTTCCATCAGATAGAATTTTATAGTTCTAGTACAAATACTCCCCACTCAGCCTTTTATGTGCTGAATTTTTGTTCAAACAATGAGATATTGCTCATATTCTTCATACTCTTTTAGAATGTCAGCAGAGGCTAAAGAAAAACACCTTGGCTGTGTCTGTAGAACCTCAACACAGTCAAGAGGATGAAGAAAATTAGACCATAAGTTATATAAACCAGTGCTGTCTCAACTCTTGACTGTCCCCTCTGGCTGCCTCTGAGTCTGAATTTCCCAAAGAACAAATTTCTGGGGAGCACTAGATTGCAGAAGAGTGGGGACAGCATTCATTCAGAGACCTTAAATATTTTATTGATACCATATTCAGCAATGAGCTTTTATATCCATTTTGAGAAATCTCCATAATTTTCAACTTGTAAACTTTTTAAAGACCTTTCTGCATTTTACACATCTGTGATTTGAATAGTGTTATCAATGTTTTTGTAAATATTTAATATGTTTTTCTATTTAGCTAAATTCCAG