Transcript asmbl_66809

Sequence
Transcript Sequence for observation asmbl_66809 of TGE0007383:
GGCCAGGACAAAAGCCGGATCCCGGGCGGTGGCGGGAGGGTGGCGCGCTCCGGGTAGTGGCCTGTGATTCAAGGCCTGTGGAGGGAGCGCCGCGCACAGACTTTCGCAGAGAGGTAGAGCAGGTCCCTCTGCAGCCATGTCGGCCAAGGCGATTTCAGAGCAGACTGGCAAAGAACTTCTTTACAAGTACATCTGCACCAGCTCGGCCATCCAGAACCGGTTCAAGTATGCCAGGGTCACCCCTGACACAGACTGGGCCCATCTGCTGCAGGACCACCCCTGGTTGCTCAGCCAAAGATTGGTGGTCAAGCCAGACCAACTGATCAAACGACGTGGAAAGCTGGGCCTAGTTGGGGTCAACCTCACTCTGGATGGTGTCAAGTCCTGGCTGAAGCCACGGCTGGGACAGGAAGCTCTGGTAGGCAAGGCCAGAGGCTTACTCAAGAACTTTCTGATCGAACCCTTCGTCCCACACAGTCAGGCAGAAGAGTTCTACGTCTGCATCTATGCTACCCGAGAAGGTGACTACGTCCTGTTCCACCACGAGGGAGGGGTGGACGTAGGCGACGTGGATGCCAAAGCCCAGAAACTGCTCGTTGGTGTGGATGAGAAGCTGAATCCTGAGGACATCAAGAAACACCTATTGGTCCATGCCCCTAAAGACAAGAAAGAAATTCTGGCCAGTTTTATCTCCGGCCTCTTCAATTTATATGAAGATCTGTACTTCACCTACCTCGAGATCAACCCCCTTGTTGTGACCAAAGATGGCGTCTACATTCTTGACTTGGCGGCTAAGGTAGATGCCACTGCCGATTACATCTGCAAAGTGAAGTGGGGCGATATAGAGTTCCCTCCCCCCTTTGGGCGTGAGGCTTATCCAGAGGAAGCCTACATTGCAGACCTGGATGCCAAAAGTGGAGCAAGCCTGAAGCTGACCTTGCTGAACCCCAAGGGGAGGATCTGGACCATGGTGGCTGGGGGTGGTGCCTCAGTCGTGTACAGTGATACCATCTGTGACCTAGGGGGTGTCAATGAGCTGGCGAACTATGGGGAGTACTCGGGTGCCCCCAGCGAGCAGCAGACCTATGACTATGCCAAGACGATCCTCTCCCTCATGACCCGCGAGAAGCACCCAGATGGCAAGATCCTCATCATTGGAGGCAGCATTGCGAACTTTACCAACGTGGCTGCCACGTTCAAGGGTATTGTGAGAGCGATTCGAGATTTCCAGGGCCCCCTAAAGGAGCACGAGGTCACTATCTTTGTCCGAAGAGGTGGTCCCAACTATCAAGAGGGCTTACGGGTGATGGGAGAAGTTGGGAAGACCACTGGAATCCCCATCCATGTGTTTGGCACAGAGACTCATATGACGGCCATTGTGGGCATGGCCCTGGGCCACCGGCCCATCCCCAATCAGCCACCTACAGCCGCCCATACTGCAAACTTCCTCCTCAACGCCAGTGGGAGCACATCGACTCCAGCCCCCAGCAGGACTGCGTCTTTTTCTGAGTCCAAGGCTGATGAAGTGGCACCTGCAAAGAAGGCCAAGCCTGCTATACCACAGGATTCAGTCCCAAGTCCAAGATCCCTGCAAGGGAGGAGTGCCACCCTCTTCAGCCACCACACCAAGGCCATCGTGTGGGGCATGCAGACGCGGGCCGTGCAAGGCATGCTGGACTTTGACTACGTCTGCTCCAGAGACGAGCCCTCAGTGGCTGCCATGGTCTACCCTTTCACTGGGGACCACAAGCAGAAGTTTTATTGGGGTCACAAAGAGATCCTGATCCCTGTCTTCAAGAACATGGCTGATGCCATGAAGAAACACCCTGAGGTAGATGTGCTGATCAACTTCGCCTCTCTCCGCTCCGCCTATGACAGTACCGTTGAGACCATGAGTTATGCACAGATCCGGACCATTGCCATCATAGCTGAAGGTATCCCTGAGGCCCTCACGAGGAAGCTGATCAAGAAGGCAGAGCAGAAGGGTGTGACCATCATTGGACCTGCCACTGTTGGAGGCATCAAGCCTGGGTGCTTTAAAATCGGGAATACAGGTGGGATGCTGGACAACATCCTGGCTTCCAAACTGTACCGCCCTGGCAGCGTGGCCTACATCTCGCGTTCTGGGGGCATGTCCAACGAGCTCAACAATATCATCTCTCGAACCACGGATGGTGTCTATGAGGGCGTGGCCATTGGTGGGGACAGGTACCCTGGTTCAACATTTATGGATCACGTGTTACGTTACCAGGACACTCCAGGAGTCAAAATGATTGTGGTTCTTGGAGAGATAGGGGGCACTGAGGAGTATAAGATCTGCCGGGGCATCAAGGAGGGCCGCCTCACCAAGCCTGTGGTCTGCTGGTGCATCGGGACCTGTGCTACCATGTTCTCTTCTGAGGTACAATTTGGCCATGCCGGAGCTTGTGCCAACCAGGCTTCTGAAACTGCAGTAGCCAAGAACCAGGCTTTGAAAGAGGCAGGAGTCTTTGTGCCCCGGAGCTTCGATGAACTTGGAGAAATCATCCAGTCTGTGTACGAGGATCTTGTGGCCAAAGGGGCCATTGTACCTGCTCAGGAGGTACCGCCCCCGACGGTGCCGATGGACTACTCCTGGGCCAGGGAGCTGGGCTTGATCCGCAAACCTGCCTCATTCATGACCAGCATCTGCGACGAGCGAGGACAGGAGCTCATCTACGCGGGTATGCCCATCACTGAGGTCTTCAAGGAAGAGATGGGCATTGGCGGGGTCCTCGGTCTCCTCTGGTTCCAGAGAAGGTTGCCCAAGTACTCCTGCCAGTTCCTTGAGATGTGCCTGATGGTGACAGCCGATCATGGGCCAGCCGTGTCTGGCGCTCACAATACCATCATCTGTGCTCGGGCTGGGAAGGACCTGGTTTCCAGCCTCACCTCGGGGCTGCTCACTATTGGGGACCGGTTTGGGGGCGCCCTGGATGCAGCAGCCAAGATGTTCAGCAAAGCCTTCGACAGTGGCATTATTCCCATGGAGTTTGTAAACAAGATGAAGAAGGAAGGAAAACTGATCATGGGCATCGGTCACCGAGTGAAGTCGATAAATAACCCAGACATGCGAGTGCAGATCCTCAAAGATTACGTCAAACAGCACTTCCCTGCCACCCCCCTGCTCGACTATGCGCTGGAAGTGGAGAAGATTACCACCTCAAAGAAACCGAATCTTATCCTGAATGTAGATGGCTTCATCGGAGCTGCATTTGTAGACATGCTTAGAAACTGTGGGTCCTTTACTCGGGAAGAAGCTGATGAATATATTGACATTGGAGCCCTCAATGGCATCTTTGTGCTGGGAAGGAGTATGGGCTTCATTGGACACTATCTTGATCAGAAGAGACTGAAGCAGGGGCTGTATCGTCACCCATGGGATGATATTTCATATGTTCTTCCGGAACACATGAGCATGTAACTGAGCCAGGAACTGTGTTGCAGTAAAGTGAAGACAAGATCTCCTCCCCCCAGAAATAGTGTGCAGACAGCTGGCACTGGAGCTTGCTATAGGATGGGCCTGGAATATAAACAGCCGTTGGTATACAGGCACCGAAGACCAATACTCACAGGCTAACACTGTTTAGTCCACACAATGAAGCTTAATATTTTTTTTATAAGCATAGAAATAAAAACCAAGCCAATATTTGTGACATCTGCTCTGCCACCTGCTGTGTTTATTATATAAAAGCATCTAAGCACTGTCAGGATGGCATTTTTCCTTATTATAGGGCGTTATAATGTTGCTTTCTTTTTTCCGTTAGTTAAAAATTTTCCCTTGGAGGAAGGGAATGAAACTTTTAAGACTTCAAGATATTATACATTTAAAGCATCCCTAATGTCTTGTTTTCCTGCTTATATAACCTGAAGAGCATTGTATTAATCTGATTTTTTTTTATGATCTTTTTGTATGTTATGCGTGAAGGATTTGTTCGGTATCTCACTGAAACATTTCATGTTGTAGACTAAAGTCTGCTTCTGTCAGGGGGATTGGACCATTGCATCCTTAGCCACTATCACAAAATATGTGGAATAGTGATTTAAAATGTAAAGTTGCAACATACATGTTTAAAATGGAAACACAAAGAAAAAGCTGTGAAATGTCTTGTGTCTTATGTTCTCTGTATTTATGCAACTGATCTGTCTTACTGAAGTCTGGGTCCAAGGACTCATCTCCAACCAGTTTGCATCTGTAATCCACAAAGATTCTGGGCAGCTCCCACCTCAGTCTCTTCTCTGTATTATCATAATTTGGTTTAAATAAACTATATAGTAACAATGAA